Incidental Mutation 'R4367:Bckdk'
ID325808
Institutional Source Beutler Lab
Gene Symbol Bckdk
Ensembl Gene ENSMUSG00000030802
Gene Namebranched chain ketoacid dehydrogenase kinase
SynonymsBCKD-kinase
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location127904082-127910221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 127906419 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Valine at position 238 (A238V)
Ref Sequence ENSEMBL: ENSMUSP00000146115 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071056] [ENSMUST00000124533] [ENSMUST00000151451] [ENSMUST00000206140] [ENSMUST00000206745]
Predicted Effect probably benign
Transcript: ENSMUST00000071056
AA Change: A238V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
SMART Domains Protein: ENSMUSP00000070345
Gene: ENSMUSG00000030802
AA Change: A238V

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
Pfam:BCDHK_Adom3 69 222 1.8e-44 PFAM
HATPase_c 264 404 2.06e-15 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000124533
AA Change: A238V

PolyPhen 2 Score 0.071 (Sensitivity: 0.94; Specificity: 0.84)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000146574
Predicted Effect probably benign
Transcript: ENSMUST00000151451
SMART Domains Protein: ENSMUSP00000116990
Gene: ENSMUSG00000030802

DomainStartEndE-ValueType
low complexity region 7 35 N/A INTRINSIC
Pfam:BCDHK_Adom3 68 214 1.4e-43 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000206068
Predicted Effect probably benign
Transcript: ENSMUST00000206140
Predicted Effect probably benign
Transcript: ENSMUST00000206745
AA Change: A238V

PolyPhen 2 Score 0.014 (Sensitivity: 0.96; Specificity: 0.79)
Meta Mutation Damage Score 0.102 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The branched-chain alpha-ketoacid dehydrogenase complex (BCKD) is an important regulator of the valine, leucine, and isoleucine catabolic pathways. The protein encoded by this gene is found in the mitochondrion, where it phosphorylates and inactivates BCKD. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Nullizygous mutations lead to altered amino acid metabolism, gait anomalies and neurobehavioral phenotypes. Homozygotes for a gene trapped allele show impaired growth, reduced fertility and epileptic seizures. Homozygotes for another gene trapped allele show motor delay and autism-like behaviors. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Bckdk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01620:Bckdk APN 7 127905776 missense possibly damaging 0.67
IGL02176:Bckdk APN 7 127906373 missense probably benign 0.31
IGL02444:Bckdk APN 7 127907446 missense probably damaging 1.00
R2105:Bckdk UTSW 7 127907317 missense probably damaging 1.00
R2240:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R2252:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R2474:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3696:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3697:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3747:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3749:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3750:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R3981:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R4091:Bckdk UTSW 7 127905418 missense probably damaging 1.00
R4303:Bckdk UTSW 7 127905330 intron probably benign
R4369:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4371:Bckdk UTSW 7 127906419 missense probably benign 0.07
R4841:Bckdk UTSW 7 127905461 unclassified probably null
R5615:Bckdk UTSW 7 127907317 missense probably damaging 1.00
R5930:Bckdk UTSW 7 127905973 missense probably damaging 1.00
R7215:Bckdk UTSW 7 127905110 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- CCCTTAGGGCTGAGGATGGG -3'
(R):5'- CCCTCCACTAGTTTAAGATGTCAG -3'

Sequencing Primer
(F):5'- CTGAGGATGGGCTTGGGGC -3'
(R):5'- AAGAGCACTTGCCCTTCCTTATAGAG -3'
Posted On2015-07-06