Incidental Mutation 'R4367:Podnl1'
Institutional Source Beutler Lab
Gene Symbol Podnl1
Ensembl Gene ENSMUSG00000012889
Gene Namepodocan-like 1
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.161) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosomal Location84125989-84132527 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 84127268 bp
Amino Acid Change Arginine to Histidine at position 89 (R89H)
Ref Sequence ENSEMBL: ENSMUSP00000091073 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093380]
Predicted Effect probably benign
Transcript: ENSMUST00000093380
AA Change: R89H

PolyPhen 2 Score 0.029 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000091073
Gene: ENSMUSG00000012889
AA Change: R89H

signal peptide 1 20 N/A INTRINSIC
LRRNT 38 71 1.91e0 SMART
LRR 70 89 1.81e2 SMART
LRR 90 115 1.76e-1 SMART
LRR 116 139 1.19e2 SMART
LRR 162 186 1.06e1 SMART
LRR 191 210 5.42e1 SMART
LRR 211 231 1.66e1 SMART
LRR 233 257 3.98e1 SMART
LRR_TYP 258 281 7.9e-4 SMART
LRR 304 328 9.24e1 SMART
LRR_TYP 329 352 4.72e-2 SMART
LRR 375 399 2.61e2 SMART
LRR_TYP 400 423 2.61e-4 SMART
LRR 424 444 3.18e1 SMART
LRR 445 470 3.27e1 SMART
LRR_TYP 471 494 3.63e-3 SMART
LRR 495 515 1.97e1 SMART
LRR 516 541 2.03e2 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147175
Meta Mutation Damage Score 0.116 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Podnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02738:Podnl1 APN 8 84132195 missense probably benign 0.31
IGL03151:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03197:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03198:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03225:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03290:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03368:Podnl1 APN 8 84132189 missense probably benign 0.44
IGL03493:Podnl1 APN 8 84132189 missense probably benign 0.44
PIT4472001:Podnl1 UTSW 8 84127848 missense
R1056:Podnl1 UTSW 8 84129276 missense probably benign 0.00
R1962:Podnl1 UTSW 8 84127297 missense probably benign 0.04
R4412:Podnl1 UTSW 8 84130665 missense probably benign 0.00
R4473:Podnl1 UTSW 8 84131985 missense possibly damaging 0.89
R4715:Podnl1 UTSW 8 84126061 start gained probably benign
R5009:Podnl1 UTSW 8 84126258 missense probably benign 0.01
R5013:Podnl1 UTSW 8 84126336 missense probably damaging 0.99
R5153:Podnl1 UTSW 8 84130643 missense probably benign 0.00
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-06