Incidental Mutation 'R4367:Tfam'
ID325818
Institutional Source Beutler Lab
Gene Symbol Tfam
Ensembl Gene ENSMUSG00000003923
Gene Nametranscription factor A, mitochondrial
SynonymsHmgts, tsHMG, mtTFA
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location71225464-71238280 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 71233403 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 119 (I119N)
Ref Sequence ENSEMBL: ENSMUSP00000113581 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092430] [ENSMUST00000105432] [ENSMUST00000121685] [ENSMUST00000152505]
Predicted Effect probably damaging
Transcript: ENSMUST00000092430
AA Change: I163N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000090086
Gene: ENSMUSG00000003923
AA Change: I163N

DomainStartEndE-ValueType
HMG 48 118 4.91e-21 SMART
low complexity region 129 148 N/A INTRINSIC
HMG 153 219 4.66e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105432
AA Change: I135N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101072
Gene: ENSMUSG00000003923
AA Change: I135N

DomainStartEndE-ValueType
HMG 20 90 4.91e-21 SMART
low complexity region 101 120 N/A INTRINSIC
HMG 125 191 4.66e-13 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000121685
AA Change: I119N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113581
Gene: ENSMUSG00000003923
AA Change: I119N

DomainStartEndE-ValueType
HMG 4 74 4.91e-21 SMART
low complexity region 85 104 N/A INTRINSIC
HMG 109 175 4.66e-13 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145220
Predicted Effect probably damaging
Transcript: ENSMUST00000152505
AA Change: I119N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000120871
Gene: ENSMUSG00000003923
AA Change: I119N

DomainStartEndE-ValueType
HMG 4 74 4.91e-21 SMART
low complexity region 85 104 N/A INTRINSIC
Blast:HMG 109 143 6e-16 BLAST
Meta Mutation Damage Score 0.0312 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a key mitochondrial transcription factor containing two high mobility group motifs. The encoded protein also functions in mitochondrial DNA replication and repair. Sequence polymorphisms in this gene are associated with Alzheimer's and Parkinson's diseases. There are pseudogenes for this gene on chromosomes 6, 7, and 11. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2012]
PHENOTYPE: Homozygous null mutants exhibit retarded growth, abnormal somite development, lack of optic discs, cardiac defects and delayed neural development. Mutants die by embryonic day 10.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Tfam
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01773:Tfam APN 10 71236975 missense possibly damaging 0.56
PIT4142001:Tfam UTSW 10 71234983 missense possibly damaging 0.88
R1462:Tfam UTSW 10 71235550 missense probably damaging 1.00
R1462:Tfam UTSW 10 71235550 missense probably damaging 1.00
R4675:Tfam UTSW 10 71233395 missense probably benign 0.22
R4684:Tfam UTSW 10 71237847 missense probably benign
Predicted Primers PCR Primer
(F):5'- GAGACACAATACATTTCCATTTGCG -3'
(R):5'- TTACAAATCCCACCGTGCTG -3'

Sequencing Primer
(F):5'- GATTTTCCTTCATCATGCGACATG -3'
(R):5'- GCATCTGCACTGGGAAGTG -3'
Posted On2015-07-06