Incidental Mutation 'R4367:Sdf2'
ID325822
Institutional Source Beutler Lab
Gene Symbol Sdf2
Ensembl Gene ENSMUSG00000002064
Gene Namestromal cell derived factor 2
Synonyms
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.620) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location78245746-78255496 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 78251037 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 66 (T66I)
Ref Sequence ENSEMBL: ENSMUSP00000002133 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000002133]
Predicted Effect probably damaging
Transcript: ENSMUST00000002133
AA Change: T66I

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000002133
Gene: ENSMUSG00000002064
AA Change: T66I

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
MIR 29 83 2.24e-11 SMART
MIR 91 146 5.47e-15 SMART
MIR 148 201 8.36e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133020
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154080
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is believed to be a secretory protein. It has regions of similarity to hydrophilic segments of yeast mannosyltransferases. Its expression is ubiquitous and the gene appears to be relatively conserved among mammals. Alternate splicing results in both coding and non-coding variants. A pseudogene of this gene is located on chromosome 15. [provided by RefSeq, Dec 2011]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Sdf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02423:Sdf2 APN 11 78251018 missense probably damaging 1.00
R1591:Sdf2 UTSW 11 78254993 missense probably damaging 0.96
R2919:Sdf2 UTSW 11 78254854 missense probably damaging 0.97
R2920:Sdf2 UTSW 11 78254854 missense probably damaging 0.97
R4371:Sdf2 UTSW 11 78251037 missense probably damaging 1.00
R5970:Sdf2 UTSW 11 78246080 missense probably benign
R7130:Sdf2 UTSW 11 78245997 start codon destroyed probably null
Predicted Primers PCR Primer
(F):5'- TGTCAAGATCTAGAGATGCTGTAGAAG -3'
(R):5'- GCTAAGCACCAAGAGGCCAG -3'

Sequencing Primer
(F):5'- AGAAGGAGGTGTGATAGAGGTTTTCC -3'
(R):5'- CCAAGAGGCCAGACAAGTAGC -3'
Posted On2015-07-06