Incidental Mutation 'R4367:Nutm2'
ID325825
Institutional Source Beutler Lab
Gene Symbol Nutm2
Ensembl Gene ENSMUSG00000071909
Gene NameNUT family member 2
SynonymsLOC328250, Gm806
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location50467307-50475355 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 50469884 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 206 (T206S)
Ref Sequence ENSEMBL: ENSMUSP00000094390 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096633]
Predicted Effect probably benign
Transcript: ENSMUST00000096633
AA Change: T206S

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000094390
Gene: ENSMUSG00000071909
AA Change: T206S

DomainStartEndE-ValueType
Pfam:NUT 27 733 9e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185962
Meta Mutation Damage Score 0.1208 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Nutm2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00885:Nutm2 APN 13 50474860 missense probably benign 0.18
IGL01087:Nutm2 APN 13 50469629 missense probably damaging 1.00
IGL01707:Nutm2 APN 13 50469717 missense probably damaging 0.96
IGL02085:Nutm2 APN 13 50473793 splice site probably null
IGL02238:Nutm2 APN 13 50471039 missense probably damaging 1.00
IGL02369:Nutm2 APN 13 50469908 missense probably benign 0.16
IGL02429:Nutm2 APN 13 50469480 missense probably benign 0.44
IGL03083:Nutm2 APN 13 50467444 missense probably damaging 0.98
R0233:Nutm2 UTSW 13 50467405 missense probably benign 0.41
R0233:Nutm2 UTSW 13 50467405 missense probably benign 0.41
R0321:Nutm2 UTSW 13 50472955 missense probably damaging 0.98
R1481:Nutm2 UTSW 13 50469481 missense probably damaging 0.99
R1605:Nutm2 UTSW 13 50469919 missense possibly damaging 0.68
R1679:Nutm2 UTSW 13 50469386 missense probably benign 0.17
R1744:Nutm2 UTSW 13 50469354 missense probably benign 0.03
R1768:Nutm2 UTSW 13 50473116 missense probably damaging 1.00
R1969:Nutm2 UTSW 13 50473842 missense probably damaging 1.00
R2026:Nutm2 UTSW 13 50474820 missense probably benign 0.00
R2187:Nutm2 UTSW 13 50467417 missense probably benign 0.00
R3912:Nutm2 UTSW 13 50472940 missense possibly damaging 0.92
R4025:Nutm2 UTSW 13 50469353 missense probably benign
R4668:Nutm2 UTSW 13 50472997 missense probably benign 0.18
R4940:Nutm2 UTSW 13 50474873 missense possibly damaging 0.58
R4987:Nutm2 UTSW 13 50472343 missense possibly damaging 0.93
R4988:Nutm2 UTSW 13 50472343 missense possibly damaging 0.93
R5821:Nutm2 UTSW 13 50469855 missense probably benign 0.01
R5986:Nutm2 UTSW 13 50474460 missense probably damaging 1.00
R6189:Nutm2 UTSW 13 50469738 missense possibly damaging 0.91
R7101:Nutm2 UTSW 13 50472898 missense probably benign 0.00
R7192:Nutm2 UTSW 13 50473069 missense probably damaging 1.00
X0028:Nutm2 UTSW 13 50472954 missense probably benign 0.04
Predicted Primers PCR Primer
(F):5'- TCATGACAACACCTGCTGC -3'
(R):5'- AGTGGACCCATCAACTTCAGC -3'

Sequencing Primer
(F):5'- TGCTGCAAACAACTTCATAAATACC -3'
(R):5'- GGACCCATCAACTTCAGCACTTTC -3'
Posted On2015-07-06