Incidental Mutation 'R4367:Myh11'
ID325827
Institutional Source Beutler Lab
Gene Symbol Myh11
Ensembl Gene ENSMUSG00000018830
Gene Namemyosin, heavy polypeptide 11, smooth muscle
SynonymssmMHC, SM1, SM2
MMRRC Submission 041673-MU
Accession Numbers

Genbank: NM_013607, NM_001161775

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location14194535-14291372 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14218883 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 985 (D985G)
Ref Sequence ENSEMBL: ENSMUSP00000155052 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000090287] [ENSMUST00000230397] [ENSMUST00000231567]
Predicted Effect probably benign
Transcript: ENSMUST00000090287
AA Change: D985G

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000087756
Gene: ENSMUSG00000018830
AA Change: D985G

DomainStartEndE-ValueType
Pfam:Myosin_N 33 73 1e-15 PFAM
MYSc 79 784 N/A SMART
IQ 785 807 1.09e-2 SMART
Pfam:Myosin_tail_1 848 1928 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000230397
AA Change: D985G

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000231567
AA Change: D992G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Meta Mutation Damage Score 0.18 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a smooth muscle myosin belonging to the myosin heavy chain family. The gene product is a subunit of a hexameric protein that consists of two heavy chain subunits and two pairs of non-identical light chain subunits. It functions as a major contractile protein, converting chemical energy into mechanical energy through the hydrolysis of ATP. The gene encoding a human ortholog of rat NUDE1 is transcribed from the reverse strand of this gene, and its 3' end overlaps with that of the latter. The pericentric inversion of chromosome 16 [inv(16)(p13q22)] produces a chimeric transcript that encodes a protein consisting of the first 165 residues from the N terminus of core-binding factor beta in a fusion with the C-terminal portion of the smooth muscle myosin heavy chain. This chromosomal rearrangement is associated with acute myeloid leukemia of the M4Eo subtype. Alternative splicing generates isoforms that are differentially expressed, with ratios changing during muscle cell maturation. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mice have impaired smooth muscle contractility. They are incapable of urinating, exhibit dilative cardiomyopathy, are growth retarded, and die within 3 days of birth. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(4)

Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Myh11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01362:Myh11 APN 16 14277722 missense probably benign 0.00
IGL01398:Myh11 APN 16 14202100 missense probably damaging 0.99
IGL01646:Myh11 APN 16 14221775 missense probably damaging 1.00
IGL02470:Myh11 APN 16 14218046 missense probably damaging 1.00
IGL02680:Myh11 APN 16 14209520 missense probably benign 0.02
IGL02687:Myh11 APN 16 14212618 nonsense probably null
IGL02987:Myh11 APN 16 14232532 missense probably damaging 1.00
IGL03008:Myh11 APN 16 14204753 missense probably benign 0.00
G5030:Myh11 UTSW 16 14250579 missense probably damaging 1.00
PIT4618001:Myh11 UTSW 16 14201066 missense
R0008:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0085:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0086:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0087:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0096:Myh11 UTSW 16 14204367 missense possibly damaging 0.94
R0207:Myh11 UTSW 16 14211260 missense possibly damaging 0.95
R0326:Myh11 UTSW 16 14218880 missense probably benign 0.32
R0546:Myh11 UTSW 16 14205628 missense probably damaging 1.00
R0658:Myh11 UTSW 16 14224019 missense probably damaging 1.00
R0715:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R0839:Myh11 UTSW 16 14203178 missense probably damaging 1.00
R1014:Myh11 UTSW 16 14236410 missense possibly damaging 0.70
R1104:Myh11 UTSW 16 14202127 missense possibly damaging 0.53
R1426:Myh11 UTSW 16 14205931 nonsense probably null
R1560:Myh11 UTSW 16 14226620 nonsense probably null
R1714:Myh11 UTSW 16 14236368 critical splice donor site probably null
R1742:Myh11 UTSW 16 14220044 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14200758 missense probably damaging 1.00
R1750:Myh11 UTSW 16 14215790 missense probably damaging 0.98
R1753:Myh11 UTSW 16 14277870 missense probably benign
R1760:Myh11 UTSW 16 14233695 splice site probably benign
R1829:Myh11 UTSW 16 14223880 missense probably damaging 1.00
R1876:Myh11 UTSW 16 14269103 splice site probably benign
R2027:Myh11 UTSW 16 14232668 missense probably damaging 1.00
R2122:Myh11 UTSW 16 14218004 missense probably damaging 1.00
R2247:Myh11 UTSW 16 14277559 missense probably damaging 1.00
R2495:Myh11 UTSW 16 14205557 missense probably damaging 1.00
R2863:Myh11 UTSW 16 14239426 missense probably benign 0.02
R3684:Myh11 UTSW 16 14203234 missense probably benign 0.00
R3693:Myh11 UTSW 16 14217949 missense probably benign 0.01
R4080:Myh11 UTSW 16 14224059 missense possibly damaging 0.83
R4664:Myh11 UTSW 16 14226584 missense possibly damaging 0.70
R4673:Myh11 UTSW 16 14269241 missense probably damaging 0.99
R4694:Myh11 UTSW 16 14200702 missense probably damaging 1.00
R4805:Myh11 UTSW 16 14234465 missense possibly damaging 0.61
R4806:Myh11 UTSW 16 14201083 splice site probably null
R4905:Myh11 UTSW 16 14250523 missense probably benign 0.13
R4939:Myh11 UTSW 16 14239507 missense probably benign
R4964:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R4966:Myh11 UTSW 16 14205954 missense probably damaging 1.00
R5029:Myh11 UTSW 16 14205625 missense probably damaging 1.00
R5045:Myh11 UTSW 16 14239527 nonsense probably null
R5097:Myh11 UTSW 16 14205906 splice site probably null
R5288:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5385:Myh11 UTSW 16 14208008 missense possibly damaging 0.66
R5621:Myh11 UTSW 16 14244855 missense probably damaging 0.96
R5856:Myh11 UTSW 16 14205976 missense probably benign 0.00
R5869:Myh11 UTSW 16 14230800 missense probably damaging 1.00
R6019:Myh11 UTSW 16 14206074 missense probably damaging 1.00
R6024:Myh11 UTSW 16 14277703 missense probably damaging 0.99
R6139:Myh11 UTSW 16 14215874 missense probably damaging 1.00
R6209:Myh11 UTSW 16 14208291 nonsense probably null
R6373:Myh11 UTSW 16 14205130 missense possibly damaging 0.72
R6671:Myh11 UTSW 16 14226616 missense possibly damaging 0.89
R6688:Myh11 UTSW 16 14205553 missense probably damaging 1.00
R6709:Myh11 UTSW 16 14223494 critical splice donor site probably null
R7069:Myh11 UTSW 16 14218939 missense possibly damaging 0.95
R7176:Myh11 UTSW 16 14215826 missense
X0018:Myh11 UTSW 16 14277633 missense probably damaging 1.00
X0025:Myh11 UTSW 16 14209689 missense possibly damaging 0.93
X0027:Myh11 UTSW 16 14234402 missense probably damaging 1.00
Z1088:Myh11 UTSW 16 14269262 frame shift probably null
Predicted Primers PCR Primer
(F):5'- CACAGCAGACCTAGCTGATG -3'
(R):5'- AGCAAAGAACAGGGTGTATTCATC -3'

Sequencing Primer
(F):5'- GCTTGAACTACTGGGATGCAGC -3'
(R):5'- GGGTGTATTCATCCCAGCTTC -3'
Posted On2015-07-06