Incidental Mutation 'R4367:Tcirg1'
ID325830
Institutional Source Beutler Lab
Gene Symbol Tcirg1
Ensembl Gene ENSMUSG00000001750
Gene NameT cell, immune regulator 1, ATPase, H+ transporting, lysosomal V0 protein A3
SynonymsAtp6i, V-ATPase a3, ATP6a3, TIRC7, OC-116
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.496) question?
Stock #R4367 (G1)
Quality Score225
Status Validated
Chromosome19
Chromosomal Location3896050-3907133 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 3899069 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 407 (D407N)
Ref Sequence ENSEMBL: ENSMUSP00000122474 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001801] [ENSMUST00000025760] [ENSMUST00000072055] [ENSMUST00000122885] [ENSMUST00000126070] [ENSMUST00000128694] [ENSMUST00000135070] [ENSMUST00000145791]
Predicted Effect probably damaging
Transcript: ENSMUST00000001801
AA Change: D407N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000001801
Gene: ENSMUSG00000001750
AA Change: D407N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000025760
SMART Domains Protein: ENSMUSP00000025760
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 373 2.4e-11 PFAM
Pfam:Choline_kinase 135 370 8.2e-82 PFAM
Pfam:EcKinase 211 345 2.5e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000072055
SMART Domains Protein: ENSMUSP00000071933
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
low complexity region 13 24 N/A INTRINSIC
low complexity region 53 74 N/A INTRINSIC
Pfam:APH 108 358 6.4e-12 PFAM
Pfam:Choline_kinase 135 352 1.6e-84 PFAM
Pfam:EcKinase 190 329 2e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000122885
AA Change: D62N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114768
Gene: ENSMUSG00000001750
AA Change: D62N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 91 2.9e-44 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125792
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125859
Predicted Effect probably damaging
Transcript: ENSMUST00000126070
AA Change: D407N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000120531
Gene: ENSMUSG00000001750
AA Change: D407N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 27 829 1.2e-277 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126643
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127308
Predicted Effect probably benign
Transcript: ENSMUST00000128694
SMART Domains Protein: ENSMUSP00000119919
Gene: ENSMUSG00000024843

DomainStartEndE-ValueType
PDB:4DA5|B 1 150 2e-60 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131327
Predicted Effect probably benign
Transcript: ENSMUST00000132164
SMART Domains Protein: ENSMUSP00000120968
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
Pfam:V_ATPase_I 1 190 4.5e-48 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134698
Predicted Effect probably benign
Transcript: ENSMUST00000135070
SMART Domains Protein: ENSMUSP00000121241
Gene: ENSMUSG00000001750

DomainStartEndE-ValueType
low complexity region 59 70 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000145791
AA Change: D407N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122474
Gene: ENSMUSG00000001750
AA Change: D407N

DomainStartEndE-ValueType
Pfam:V_ATPase_I 26 830 4.4e-287 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159824
Predicted Effect noncoding transcript
Transcript: ENSMUST00000162688
Meta Mutation Damage Score 0.284 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Through alternate splicing, this gene encodes two proteins with similarity to subunits of the vacuolar ATPase (V-ATPase) but the encoded proteins seem to have different functions. V-ATPase is a multisubunit enzyme that mediates acidification of eukaryotic intracellular organelles. V-ATPase dependent organelle acidification is necessary for such intracellular processes as protein sorting, zymogen activation, and receptor-mediated endocytosis. V-ATPase is comprised of a cytosolic V1 domain and a transmembrane V0 domain. Mutations in this gene are associated with infantile malignant osteopetrosis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for mutant alleles exhibit severe osteopetrosis with increased bone density due to failure of secondary bone resorption. Mutants lack teeth and die around 30-40 days of age. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Drp2 A T X: 134,435,135 probably benign Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Tcirg1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00488:Tcirg1 APN 19 3899108 missense possibly damaging 0.94
IGL01735:Tcirg1 APN 19 3904210 splice site probably benign
IGL03143:Tcirg1 APN 19 3898811 missense probably damaging 1.00
R0732:Tcirg1 UTSW 19 3897866 missense possibly damaging 0.56
R1131:Tcirg1 UTSW 19 3896301 missense probably damaging 1.00
R1223:Tcirg1 UTSW 19 3898733 missense probably benign 0.01
R1548:Tcirg1 UTSW 19 3896845 missense probably benign 0.03
R1867:Tcirg1 UTSW 19 3898835 missense probably damaging 1.00
R1926:Tcirg1 UTSW 19 3902843 intron probably benign
R2262:Tcirg1 UTSW 19 3903591 missense possibly damaging 0.89
R5327:Tcirg1 UTSW 19 3902342 critical splice donor site probably null
R5417:Tcirg1 UTSW 19 3903509 splice site probably null
R5551:Tcirg1 UTSW 19 3898858 missense probably damaging 1.00
R5930:Tcirg1 UTSW 19 3902424 missense possibly damaging 0.95
R6026:Tcirg1 UTSW 19 3897487 missense probably benign
R6517:Tcirg1 UTSW 19 3901933 missense probably damaging 1.00
R7039:Tcirg1 UTSW 19 3896666 missense probably damaging 1.00
R7181:Tcirg1 UTSW 19 3903576 missense probably null 0.56
Predicted Primers PCR Primer
(F):5'- CCAAAGAAGGTCTGCCAGATC -3'
(R):5'- TCTGAAATGTGCCAAGTGGTCC -3'

Sequencing Primer
(F):5'- CCAGGGGGAGATGGTGTGC -3'
(R):5'- AGTGGTCCCTGCCTCATAAAC -3'
Posted On2015-07-06