Incidental Mutation 'R4367:Drp2'
ID325832
Institutional Source Beutler Lab
Gene Symbol Drp2
Ensembl Gene ENSMUSG00000000223
Gene Namedystrophin related protein 2
Synonyms
MMRRC Submission 041673-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4367 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location134404551-134456573 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 134435135 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113224] [ENSMUST00000113226] [ENSMUST00000113228] [ENSMUST00000153424]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000000228
Predicted Effect probably benign
Transcript: ENSMUST00000113224
SMART Domains Protein: ENSMUSP00000108850
Gene: ENSMUSG00000000223

DomainStartEndE-ValueType
SPEC 129 251 5e-7 SMART
SPEC 258 360 6.4e-7 SMART
WW 377 409 4.6e-10 SMART
Pfam:EF-hand_2 410 528 9.5e-36 PFAM
Pfam:EF-hand_3 532 623 9.1e-35 PFAM
ZnF_ZZ 628 673 1e-17 SMART
coiled coil region 800 900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113226
SMART Domains Protein: ENSMUSP00000108852
Gene: ENSMUSG00000000223

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113228
SMART Domains Protein: ENSMUSP00000108854
Gene: ENSMUSG00000000223

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142146
Predicted Effect probably benign
Transcript: ENSMUST00000153424
SMART Domains Protein: ENSMUSP00000115246
Gene: ENSMUSG00000000223

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 98% (54/55)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the dystrophin family of proteins perform a critical role in the maintenance of membrane-associated complexes at points of intercellular contact in vertebrate cells. The protein encoded by this gene is predicted to resemble certain short C-terminal isoforms of dystrophin and dystrophin-related protein 1 (DRP1 or utrophin). DRP2 is expressed principally in the brain and spinal cord. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a conditional allele activated in peripheral nerves exhibit abnormal Scwann cell morphology, supernumerary Schwann cell, abnormal myelin sheath morphology and hypermyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adrb2 T C 18: 62,179,056 I233V probably damaging Het
Alox5 T A 6: 116,460,963 Y21F possibly damaging Het
Ank2 T C 3: 126,946,149 T1942A probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Casp1 A G 9: 5,299,333 T21A probably benign Het
Ccdc39 T C 3: 33,826,522 H432R probably benign Het
Cttnbp2 A C 6: 18,405,249 C574G probably damaging Het
Cyp1a1 T C 9: 57,700,149 V20A probably benign Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Dnah6 A G 6: 73,149,484 S1287P possibly damaging Het
Dnttip2 T C 3: 122,276,497 S454P probably damaging Het
Doxl2 T C 6: 48,976,130 S330P probably damaging Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Fmo1 G C 1: 162,833,648 Y355* probably null Het
Git2 T A 5: 114,764,666 H138L probably damaging Het
Gpr162 G A 6: 124,861,695 probably benign Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Kcnt1 T C 2: 25,907,626 I881T probably damaging Het
Lama3 T A 18: 12,513,690 C1754S probably damaging Het
Mpp3 A T 11: 102,023,420 D116E probably benign Het
Myh11 T C 16: 14,218,883 D985G probably damaging Het
Necap1 T C 6: 122,887,378 V273A probably damaging Het
Nlrc5 T C 8: 94,476,564 S431P probably damaging Het
Nutm2 A T 13: 50,469,884 T206S probably benign Het
Olfr27 G A 9: 39,144,429 A110T probably damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Olfr707 GAACAACAACAA GAACAACAA 7: 106,891,360 probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Podnl1 G A 8: 84,127,268 R89H probably benign Het
Prpf38b T C 3: 108,911,171 Y91C probably damaging Het
Radil C T 5: 142,494,805 A632T probably benign Het
Rpap2 G A 5: 107,601,795 V62I possibly damaging Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Specc1 T C 11: 62,118,530 S371P probably damaging Het
Suco T C 1: 161,847,230 E416G probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tarsl2 C T 7: 65,682,819 T556M probably damaging Het
Tcirg1 C T 19: 3,899,069 D407N probably damaging Het
Tefm G T 11: 80,140,330 L27I probably benign Het
Tenm2 A G 11: 36,027,398 I1845T probably benign Het
Tfam A T 10: 71,233,403 I119N probably damaging Het
Tle1 ACAGGTTTCTTCAGGTTTCTT ACAGGTTTCTT 4: 72,118,163 probably benign Het
Trpm6 T C 19: 18,827,525 I947T probably damaging Het
Ubqlnl C T 7: 104,149,718 V191M probably benign Het
Usp54 T C 14: 20,561,134 T1205A probably benign Het
Vmn2r25 T C 6: 123,828,537 R454G probably damaging Het
Xylb T C 9: 119,388,715 V477A probably benign Het
Other mutations in Drp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1119:Drp2 UTSW X 134441322 missense probably damaging 1.00
R1864:Drp2 UTSW X 134427115 missense probably benign 0.03
R3618:Drp2 UTSW X 134439968 missense probably benign 0.13
R4371:Drp2 UTSW X 134435135 intron probably benign
R4993:Drp2 UTSW X 134441316 missense probably damaging 0.99
R4994:Drp2 UTSW X 134441316 missense probably damaging 0.99
R4996:Drp2 UTSW X 134441316 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- ACCACAGATGATATTGGAGCAG -3'
(R):5'- AAATTTGCACAGCTCTTAGGC -3'

Sequencing Primer
(F):5'- CTGCCTTGTAAGAGAGCTCAG -3'
(R):5'- AGCTCTTAGGCTGAAGCAC -3'
Posted On2015-07-06