Incidental Mutation 'R4368:4930449A18Rik'
List |< first << previous [record 63 of 1920] next >> last >|
ID325839
Institutional Source Beutler Lab
Gene Symbol 4930449A18Rik
Ensembl Gene ENSMUSG00000074589
Gene NameRIKEN cDNA 4930449A18 gene
Synonyms
MMRRC Submission 041115-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.329) question?
Stock #R4368 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location59777809-59846817 bp(+) (GRCm38)
Type of Mutationexon
DNA Base Change (assembly) A to G at 59846778 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192453
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932438A13Rik C T 3: 36,988,147 Q2761* probably null Het
Adamts7 G A 9: 90,195,851 probably null Het
Adgrv1 A C 13: 81,492,910 S3335R unknown Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh19 G A 1: 110,889,712 Q767* probably null Het
Cep120 G A 18: 53,685,885 probably null Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Efr3a T A 15: 65,866,780 F753I possibly damaging Het
Gm5538 T C 3: 59,751,966 F280S probably damaging Het
Hspb7 A T 4: 141,424,018 E157V probably damaging Het
Irx6 A G 8: 92,678,401 E299G probably damaging Het
Jhy T A 9: 40,917,144 N489Y possibly damaging Het
Klhl22 T C 16: 17,789,273 V481A possibly damaging Het
Mapk13 A G 17: 28,777,565 probably null Het
Meis1 A T 11: 19,010,656 probably benign Het
Nlrp14 A G 7: 107,197,805 K301E probably benign Het
Nol10 T C 12: 17,379,292 Y340H probably damaging Het
Olfr267 T C 4: 58,785,153 S190G probably benign Het
Paqr3 T C 5: 97,108,291 S75G probably damaging Het
Pdgfa T C 5: 138,986,306 T113A probably damaging Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Psph T G 5: 129,771,590 K9T probably benign Het
Ptpn21 T C 12: 98,678,593 Y1163C probably damaging Het
Scaf8 T C 17: 3,171,195 L319P unknown Het
Slc4a7 C T 14: 14,733,775 R62W probably damaging Het
Slc6a3 C A 13: 73,560,912 C318* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Taf1c A C 8: 119,599,316 S602R possibly damaging Het
Tiam2 A G 17: 3,414,683 D229G probably benign Het
Tor1a A G 2: 30,967,370 probably benign Het
Trim45 T C 3: 100,923,186 I92T probably damaging Het
Ttll8 G A 15: 88,914,181 P784S possibly damaging Het
Tubg1 G T 11: 101,125,364 probably null Het
Vmn1r178 A T 7: 23,894,022 N92I probably damaging Het
Vmn2r87 A G 10: 130,479,807 V130A probably benign Het
Wdr46 A G 17: 33,941,146 probably benign Het
Yme1l1 A G 2: 23,160,211 H18R possibly damaging Het
Zfp263 T A 16: 3,744,906 probably benign Het
Zfp534 T C 4: 147,675,558 D218G probably benign Het
Zscan12 T C 13: 21,369,383 V459A probably benign Het
Other mutations in 4930449A18Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02536:4930449A18Rik APN 3 59778244 exon noncoding transcript
R4243:4930449A18Rik UTSW 3 59825782 exon noncoding transcript
R4245:4930449A18Rik UTSW 3 59825782 exon noncoding transcript
R4466:4930449A18Rik UTSW 3 59838466 exon noncoding transcript
R4755:4930449A18Rik UTSW 3 59825859 exon noncoding transcript
R4842:4930449A18Rik UTSW 3 59841732 exon noncoding transcript
R5214:4930449A18Rik UTSW 3 59825884 splice site noncoding transcript
R5436:4930449A18Rik UTSW 3 59846693 exon noncoding transcript
Predicted Primers PCR Primer
(F):5'- TTTGCTAGTCAATGACTCCCAG -3'
(R):5'- CTCCATTTTATCAGCAACTAACACTGG -3'

Sequencing Primer
(F):5'- CAATGACTCCCAGTTACAGAGTTTGC -3'
(R):5'- TGCAATGATCTTTATGC -3'
Posted On2015-07-06