Incidental Mutation 'R4368:Scaf8'
ID325872
Institutional Source Beutler Lab
Gene Symbol Scaf8
Ensembl Gene ENSMUSG00000046201
Gene NameSR-related CTD-associated factor 8
SynonymsRbm16, A630086M08Rik, A930036P18Rik
MMRRC Submission 041115-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.811) question?
Stock #R4368 (G1)
Quality Score225
Status Validated
Chromosome17
Chromosomal Location3114972-3198859 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 3171195 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 319 (L319P)
Ref Sequence ENSEMBL: ENSMUSP00000076024 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000076734]
Predicted Effect unknown
Transcript: ENSMUST00000076734
AA Change: L319P
SMART Domains Protein: ENSMUSP00000076024
Gene: ENSMUSG00000046201
AA Change: L319P

DomainStartEndE-ValueType
RPR 6 136 1.26e-42 SMART
low complexity region 157 171 N/A INTRINSIC
low complexity region 193 223 N/A INTRINSIC
low complexity region 232 251 N/A INTRINSIC
low complexity region 271 282 N/A INTRINSIC
low complexity region 305 326 N/A INTRINSIC
low complexity region 363 380 N/A INTRINSIC
low complexity region 397 462 N/A INTRINSIC
RRM 478 547 9.2e-14 SMART
low complexity region 644 677 N/A INTRINSIC
low complexity region 685 712 N/A INTRINSIC
low complexity region 857 883 N/A INTRINSIC
low complexity region 941 953 N/A INTRINSIC
low complexity region 962 971 N/A INTRINSIC
low complexity region 1027 1044 N/A INTRINSIC
internal_repeat_1 1048 1064 2e-5 PROSPERO
internal_repeat_1 1059 1075 2e-5 PROSPERO
low complexity region 1146 1168 N/A INTRINSIC
low complexity region 1249 1268 N/A INTRINSIC
Meta Mutation Damage Score 0.31 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.6%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930449A18Rik A G 3: 59,846,778 noncoding transcript Het
4932438A13Rik C T 3: 36,988,147 Q2761* probably null Het
Adamts7 G A 9: 90,195,851 probably null Het
Adgrv1 A C 13: 81,492,910 S3335R unknown Het
Armc6 G A 8: 70,225,293 L129F probably benign Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cdh19 G A 1: 110,889,712 Q767* probably null Het
Cep120 G A 18: 53,685,885 probably null Het
Dhx38 C T 8: 109,553,131 V976I probably damaging Het
Efr3a T A 15: 65,866,780 F753I possibly damaging Het
Gm5538 T C 3: 59,751,966 F280S probably damaging Het
Hspb7 A T 4: 141,424,018 E157V probably damaging Het
Irx6 A G 8: 92,678,401 E299G probably damaging Het
Jhy T A 9: 40,917,144 N489Y possibly damaging Het
Klhl22 T C 16: 17,789,273 V481A possibly damaging Het
Mapk13 A G 17: 28,777,565 probably null Het
Meis1 A T 11: 19,010,656 probably benign Het
Nlrp14 A G 7: 107,197,805 K301E probably benign Het
Nol10 T C 12: 17,379,292 Y340H probably damaging Het
Olfr267 T C 4: 58,785,153 S190G probably benign Het
Paqr3 T C 5: 97,108,291 S75G probably damaging Het
Pdgfa T C 5: 138,986,306 T113A probably damaging Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Psph T G 5: 129,771,590 K9T probably benign Het
Ptpn21 T C 12: 98,678,593 Y1163C probably damaging Het
Slc4a7 C T 14: 14,733,775 R62W probably damaging Het
Slc6a3 C A 13: 73,560,912 C318* probably null Het
Speer3 C G 5: 13,796,380 A238G possibly damaging Het
Taf1c A C 8: 119,599,316 S602R possibly damaging Het
Tiam2 A G 17: 3,414,683 D229G probably benign Het
Tor1a A G 2: 30,967,370 probably benign Het
Trim45 T C 3: 100,923,186 I92T probably damaging Het
Ttll8 G A 15: 88,914,181 P784S possibly damaging Het
Tubg1 G T 11: 101,125,364 probably null Het
Vmn1r178 A T 7: 23,894,022 N92I probably damaging Het
Vmn2r87 A G 10: 130,479,807 V130A probably benign Het
Wdr46 A G 17: 33,941,146 probably benign Het
Yme1l1 A G 2: 23,160,211 H18R possibly damaging Het
Zfp263 T A 16: 3,744,906 probably benign Het
Zfp534 T C 4: 147,675,558 D218G probably benign Het
Zscan12 T C 13: 21,369,383 V459A probably benign Het
Other mutations in Scaf8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00496:Scaf8 APN 17 3171134 missense unknown
IGL00956:Scaf8 APN 17 3171147 missense unknown
IGL01610:Scaf8 APN 17 3195849 missense probably damaging 1.00
IGL01967:Scaf8 APN 17 3196938 missense possibly damaging 0.91
IGL02005:Scaf8 APN 17 3185870 missense probably damaging 1.00
IGL03037:Scaf8 APN 17 3190221 missense probably damaging 0.99
R0320:Scaf8 UTSW 17 3178255 missense unknown
R0789:Scaf8 UTSW 17 3196837 missense possibly damaging 0.94
R0850:Scaf8 UTSW 17 3195774 splice site probably null
R0919:Scaf8 UTSW 17 3197120 missense probably damaging 1.00
R1488:Scaf8 UTSW 17 3197597 missense probably damaging 0.97
R1544:Scaf8 UTSW 17 3145154 missense probably damaging 0.96
R1928:Scaf8 UTSW 17 3168077 missense unknown
R1972:Scaf8 UTSW 17 3169371 missense unknown
R2156:Scaf8 UTSW 17 3164132 splice site probably null
R2164:Scaf8 UTSW 17 3197210 missense probably damaging 1.00
R2680:Scaf8 UTSW 17 3197591 missense possibly damaging 0.95
R3794:Scaf8 UTSW 17 3190249 missense probably damaging 1.00
R4673:Scaf8 UTSW 17 3197985 missense probably benign 0.04
R4694:Scaf8 UTSW 17 3197404 missense probably damaging 1.00
R4716:Scaf8 UTSW 17 3177123 missense unknown
R4852:Scaf8 UTSW 17 3178219 missense unknown
R5036:Scaf8 UTSW 17 3164262 unclassified probably benign
R5193:Scaf8 UTSW 17 3190165 missense probably benign 0.02
R5429:Scaf8 UTSW 17 3197110 missense probably benign 0.14
R5816:Scaf8 UTSW 17 3177713 missense unknown
R6050:Scaf8 UTSW 17 3168108 missense unknown
R6493:Scaf8 UTSW 17 3171119 missense unknown
R6616:Scaf8 UTSW 17 3168055 missense unknown
R7065:Scaf8 UTSW 17 3159211 missense probably damaging 1.00
R7112:Scaf8 UTSW 17 3163029 missense unknown
R7141:Scaf8 UTSW 17 3159182 missense unknown
R7198:Scaf8 UTSW 17 3163098 missense unknown
R7265:Scaf8 UTSW 17 3177625 missense unknown
Z1088:Scaf8 UTSW 17 3162983 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- CACTGCAGTAGAGTTCCTTGTG -3'
(R):5'- GGCACAGCTATAAAGGTCTTTGAAAG -3'

Sequencing Primer
(F):5'- ACTGCAGTAGAGTTCCTTGTGTGAAG -3'
(R):5'- AAGGTCTTTGAAAGGAAATACACTAG -3'
Posted On2015-07-06