Incidental Mutation 'R4369:Bean1'
ID 325902
Institutional Source Beutler Lab
Gene Symbol Bean1
Ensembl Gene ENSMUSG00000031872
Gene Name brain expressed, associated with Nedd4, 1
Synonyms
MMRRC Submission 041116-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R4369 (G1)
Quality Score 225
Status Not validated
Chromosome 8
Chromosomal Location 104897110-104945730 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 104943742 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Aspartic acid at position 275 (V275D)
Ref Sequence ENSEMBL: ENSMUSP00000148571 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093245] [ENSMUST00000164076] [ENSMUST00000167633] [ENSMUST00000171018] [ENSMUST00000212979] [ENSMUST00000213077]
AlphaFold Q9EQG5
Predicted Effect probably damaging
Transcript: ENSMUST00000093245
AA Change: V204D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000090931
Gene: ENSMUSG00000031872
AA Change: V204D

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000164076
AA Change: V143D

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000132056
Gene: ENSMUSG00000031872
AA Change: V143D

DomainStartEndE-ValueType
low complexity region 156 171 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000167633
AA Change: V204D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000131530
Gene: ENSMUSG00000031872
AA Change: V204D

DomainStartEndE-ValueType
transmembrane domain 38 60 N/A INTRINSIC
low complexity region 70 90 N/A INTRINSIC
low complexity region 217 232 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000171018
AA Change: V275D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000129403
Gene: ENSMUSG00000031872
AA Change: V275D

DomainStartEndE-ValueType
transmembrane domain 72 94 N/A INTRINSIC
low complexity region 104 124 N/A INTRINSIC
low complexity region 288 303 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212627
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212672
Predicted Effect probably damaging
Transcript: ENSMUST00000212979
AA Change: V275D

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably damaging
Transcript: ENSMUST00000213077
AA Change: V99D

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is one of several proteins that interact with NEDD4, a member of a family of ubiquitin-protein ligases. These proteins have PY motifs in common that bind to the WW domains of NEDD4. NEDD4 is developmentally regulated, and is highly expressed in embryonic tissues. Mutations in this gene (i.e., intronic insertions of >100 copies of pentanucleotide repeats including a (TGGAA)n sequence) are associated with spinocerebellar ataxia type 31. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, May 2010]
PHENOTYPE: Mice homozygous for a null targeted allele are viable and fertile and exhibit no apparent abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 48 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730596B20Rik A T 6: 52,156,042 (GRCm39) probably benign Het
A730018C14Rik T C 12: 112,382,048 (GRCm39) noncoding transcript Het
Abcc1 T G 16: 14,278,857 (GRCm39) S1056A possibly damaging Het
Akr1c19 A T 13: 4,283,779 (GRCm39) K4* probably null Het
Amph T A 13: 19,321,870 (GRCm39) S516R probably benign Het
Apoh T C 11: 108,288,205 (GRCm39) F108L probably damaging Het
Arg2 T C 12: 79,196,746 (GRCm39) S156P probably damaging Het
AU018091 A T 7: 3,207,815 (GRCm39) L582* probably null Het
Bckdk C T 7: 127,505,591 (GRCm39) A238V probably benign Het
Brpf3 C T 17: 29,055,594 (GRCm39) A1181V probably damaging Het
Cfb T C 17: 35,079,290 (GRCm39) K287R probably damaging Het
Cpd T C 11: 76,688,537 (GRCm39) N912D possibly damaging Het
Cyp4f14 T C 17: 33,128,232 (GRCm39) N261S probably benign Het
Dennd3 T C 15: 73,412,658 (GRCm39) I440T probably damaging Het
Dhx38 C T 8: 110,279,763 (GRCm39) V976I probably damaging Het
Dpep2 T G 8: 106,711,707 (GRCm39) L573F probably benign Het
Ebag9 T C 15: 44,491,865 (GRCm39) S86P probably benign Het
Epha1 T C 6: 42,342,391 (GRCm39) Y319C probably damaging Het
Eps8l3 T C 3: 107,798,330 (GRCm39) Y466H possibly damaging Het
Ercc6 A G 14: 32,239,164 (GRCm39) E84G probably damaging Het
Ffar1 A G 7: 30,560,033 (GRCm39) I288T probably benign Het
Flnb C T 14: 7,942,216 (GRCm38) T2398I probably benign Het
Galnt15 T C 14: 31,751,496 (GRCm39) F16S possibly damaging Het
Golgb1 A G 16: 36,737,269 (GRCm39) E2172G probably damaging Het
Lhx4 T A 1: 155,580,560 (GRCm39) H161L probably benign Het
Lrp1 T C 10: 127,386,155 (GRCm39) N3457S possibly damaging Het
Map7d1 A T 4: 126,128,866 (GRCm39) S436T probably damaging Het
Nmral1 T C 16: 4,532,394 (GRCm39) Y139C probably damaging Het
Noc2l A G 4: 156,321,853 (GRCm39) D84G possibly damaging Het
Or2a25 T A 6: 42,889,211 (GRCm39) Y251* probably null Het
Or5p79 C T 7: 108,221,096 (GRCm39) L26F probably benign Het
Osbpl11 T C 16: 33,045,018 (GRCm39) S386P probably damaging Het
Papss2 A G 19: 32,618,791 (GRCm39) H283R probably damaging Het
Pcdha11 T C 18: 37,139,796 (GRCm39) V475A possibly damaging Het
Pglyrp3 T C 3: 91,935,386 (GRCm39) I212T probably damaging Het
Pkhd1l1 C T 15: 44,368,949 (GRCm39) R865W probably benign Het
Prdm9 T C 17: 15,764,708 (GRCm39) T691A probably benign Het
Rnf121 T C 7: 101,673,313 (GRCm39) D206G probably benign Het
Rnf122 T A 8: 31,602,177 (GRCm39) M1K probably null Het
Shank2 T C 7: 143,733,518 (GRCm39) S22P probably damaging Het
Smg6 C T 11: 74,823,269 (GRCm39) R175* probably null Het
Speer3 C G 5: 13,846,394 (GRCm39) A238G possibly damaging Het
Thsd7a C T 6: 12,468,907 (GRCm39) C557Y probably damaging Het
Tiam2 A G 17: 3,464,242 (GRCm39) probably benign Het
Trgv4 T C 13: 19,369,567 (GRCm39) Y104H probably benign Het
Ttn C T 2: 76,594,345 (GRCm39) W18788* probably null Het
Vmn2r82 A T 10: 79,231,914 (GRCm39) I638F probably benign Het
Zswim6 A G 13: 107,863,229 (GRCm39) noncoding transcript Het
Other mutations in Bean1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02016:Bean1 APN 8 104,937,550 (GRCm39) missense possibly damaging 0.90
R0135:Bean1 UTSW 8 104,943,807 (GRCm39) missense probably damaging 1.00
R0490:Bean1 UTSW 8 104,941,660 (GRCm39) missense possibly damaging 0.76
R1319:Bean1 UTSW 8 104,943,856 (GRCm39) missense probably benign
R1920:Bean1 UTSW 8 104,937,742 (GRCm39) missense possibly damaging 0.92
R2513:Bean1 UTSW 8 104,908,643 (GRCm39) missense probably benign 0.04
R3980:Bean1 UTSW 8 104,937,730 (GRCm39) missense possibly damaging 0.92
R4209:Bean1 UTSW 8 104,940,566 (GRCm39) start codon destroyed probably null 0.04
R4516:Bean1 UTSW 8 104,941,786 (GRCm39) missense probably damaging 1.00
R4542:Bean1 UTSW 8 104,937,591 (GRCm39) missense probably damaging 1.00
R4663:Bean1 UTSW 8 104,937,799 (GRCm39) missense probably damaging 1.00
R4962:Bean1 UTSW 8 104,943,606 (GRCm39) missense probably damaging 1.00
R5221:Bean1 UTSW 8 104,941,784 (GRCm39) missense probably damaging 1.00
R6288:Bean1 UTSW 8 104,937,622 (GRCm39) missense probably damaging 1.00
R6588:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R6615:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R6994:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7359:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7451:Bean1 UTSW 8 104,940,628 (GRCm39) missense probably benign 0.01
R7454:Bean1 UTSW 8 104,937,658 (GRCm39) missense probably damaging 1.00
R7473:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7537:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R7826:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8034:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8418:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8789:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8885:Bean1 UTSW 8 104,908,752 (GRCm39) critical splice donor site probably null
R8888:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8892:Bean1 UTSW 8 104,943,610 (GRCm39) missense probably damaging 1.00
R8896:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R8992:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9015:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9113:Bean1 UTSW 8 104,940,557 (GRCm39) missense probably benign 0.00
R9122:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9135:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9151:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9255:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9340:Bean1 UTSW 8 104,908,739 (GRCm39) missense probably damaging 0.99
R9363:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9417:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9537:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9566:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
R9731:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
RF054:Bean1 UTSW 8 104,908,664 (GRCm39) frame shift probably null
Predicted Primers PCR Primer
(F):5'- TCAGAATCTACAACCCCTGAGTG -3'
(R):5'- CGGAATTTATGAGCTTGGCCAC -3'

Sequencing Primer
(F):5'- CTCTCACAGCTATGAGGAATGCATG -3'
(R):5'- AATTTATGAGCTTGGCCACTCACAC -3'
Posted On 2015-07-06