Incidental Mutation 'R4370:Olfr1495'
ID325975
Institutional Source Beutler Lab
Gene Symbol Olfr1495
Ensembl Gene ENSMUSG00000047207
Gene Nameolfactory receptor 1495
SynonymsGA_x6K02T2RE5P-4101369-4102328, MOR266-9
MMRRC Submission 041674-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R4370 (G1)
Quality Score225
Status Not validated
Chromosome19
Chromosomal Location13764606-13770248 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 13768951 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 203 (V203A)
Ref Sequence ENSEMBL: ENSMUSP00000150205 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061669] [ENSMUST00000215930] [ENSMUST00000216980]
Predicted Effect probably benign
Transcript: ENSMUST00000061669
AA Change: V203A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000057468
Gene: ENSMUSG00000047207
AA Change: V203A

DomainStartEndE-ValueType
Pfam:7tm_4 35 312 1.4e-52 PFAM
Pfam:7tm_1 45 295 1.7e-24 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215930
AA Change: V203A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Predicted Effect probably benign
Transcript: ENSMUST00000216980
AA Change: V203A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.9%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acoxl T A 2: 127,878,788 D190E possibly damaging Het
Alg11 C A 8: 22,068,079 A469E probably benign Het
Armc2 A T 10: 41,917,200 N809K probably benign Het
Arntl2 A T 6: 146,809,651 E51V probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Cage1 G A 13: 38,025,650 S11F probably damaging Het
Car15 T C 16: 17,835,435 I289M probably damaging Het
Cfap100 A T 6: 90,413,394 I242N probably damaging Het
Dst GAA GA 1: 34,251,728 probably null Het
Epdr1 C A 13: 19,619,406 V53F probably benign Het
Gm281 C T 14: 13,862,375 S393N probably benign Het
Igfn1 A G 1: 135,968,106 M1574T probably benign Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Krtap4-7 G A 11: 99,643,717 P107S unknown Het
Lrp6 A C 6: 134,506,358 Y461* probably null Het
Mecom T A 3: 29,957,355 E723V probably damaging Het
Nsd3 T A 8: 25,648,508 I258N probably benign Het
Olfr1079 A T 2: 86,538,420 I165N possibly damaging Het
Olfr175-ps1 T A 16: 58,824,593 M39L probably benign Het
Rb1cc1 A G 1: 6,248,547 D730G probably damaging Het
Sacs A G 14: 61,212,309 R3935G probably damaging Het
Setd5 A G 6: 113,121,805 K800E probably damaging Het
Slc26a4 G T 12: 31,529,476 Q596K probably benign Het
Slc38a4 T A 15: 97,009,084 N258Y possibly damaging Het
Sntb1 A G 15: 55,792,091 I243T probably damaging Het
Sspo A G 6: 48,466,348 S2051G probably null Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tgm2 G A 2: 158,124,301 R478* probably null Het
Tgm6 T C 2: 130,143,605 Y443H probably benign Het
Tor2a T A 2: 32,758,858 D113E probably benign Het
Trio C A 15: 27,748,337 E1266* probably null Het
Usp40 T C 1: 87,997,875 I211V probably benign Het
Zfp791 C T 8: 85,113,606 V11M probably damaging Het
Other mutations in Olfr1495
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01542:Olfr1495 APN 19 13768537 missense probably damaging 1.00
IGL01869:Olfr1495 APN 19 13769170 missense probably benign 0.02
IGL02088:Olfr1495 APN 19 13768666 missense probably damaging 1.00
R1583:Olfr1495 UTSW 19 13768510 missense probably benign 0.10
R1713:Olfr1495 UTSW 19 13769295 missense probably benign 0.00
R1859:Olfr1495 UTSW 19 13768724 nonsense probably null
R3717:Olfr1495 UTSW 19 13769064 missense probably damaging 0.98
R3718:Olfr1495 UTSW 19 13769064 missense probably damaging 0.98
R3881:Olfr1495 UTSW 19 13768780 missense probably benign
R4873:Olfr1495 UTSW 19 13768762 missense probably damaging 0.99
R4875:Olfr1495 UTSW 19 13768762 missense probably damaging 0.99
R6335:Olfr1495 UTSW 19 13768780 missense probably benign
R6352:Olfr1495 UTSW 19 13768464 missense probably benign
R7038:Olfr1495 UTSW 19 13768351 missense probably benign
R7107:Olfr1495 UTSW 19 13769161 missense probably benign 0.22
R7504:Olfr1495 UTSW 19 13768732 missense probably damaging 1.00
Z1088:Olfr1495 UTSW 19 13768416 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- TGTGTCCAGATGGTAATAGGCTC -3'
(R):5'- GGCAATTTGGCGATCCTCATC -3'

Sequencing Primer
(F):5'- TCCAGATGGTAATAGGCTCTTTGAGC -3'
(R):5'- GGTCTCAGGTACACTAGGCTAC -3'
Posted On2015-07-06