Incidental Mutation 'R4371:Hepacam2'
ID325993
Institutional Source Beutler Lab
Gene Symbol Hepacam2
Ensembl Gene ENSMUSG00000044156
Gene NameHEPACAM family member 2
Synonyms
MMRRC Submission 041117-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R4371 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location3457096-3498298 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 3486988 bp
ZygosityHeterozygous
Amino Acid Change Valine to Glutamic Acid at position 123 (V123E)
Ref Sequence ENSEMBL: ENSMUSP00000058882 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049985] [ENSMUST00000200854] [ENSMUST00000201607]
Predicted Effect probably damaging
Transcript: ENSMUST00000049985
AA Change: V123E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000058882
Gene: ENSMUSG00000044156
AA Change: V123E

DomainStartEndE-ValueType
IG 39 142 7.77e-1 SMART
IGc2 165 227 6.21e-9 SMART
IG 256 334 1.87e0 SMART
transmembrane domain 351 373 N/A INTRINSIC
low complexity region 420 437 N/A INTRINSIC
Predicted Effect
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184051
AA Change: V136E
Predicted Effect probably damaging
Transcript: ENSMUST00000200854
AA Change: V47E

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000144362
Gene: ENSMUSG00000044156
AA Change: V47E

DomainStartEndE-ValueType
IG_like 2 66 2.88e1 SMART
IGc2 89 151 6.21e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200972
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201276
Predicted Effect probably damaging
Transcript: ENSMUST00000201607
AA Change: V47E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143834
Gene: ENSMUSG00000044156
AA Change: V47E

DomainStartEndE-ValueType
IG_like 2 66 1.2e-1 SMART
IGc2 89 151 2.5e-11 SMART
Blast:IG 180 206 9e-11 BLAST
Meta Mutation Damage Score 0.134 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein related to the immunoglobulin superfamily that plays a role in mitosis. Knockdown of this gene results in prometaphase arrest, abnormal nuclear morphology and apoptosis. Poly(ADP-ribosylation) of the encoded protein promotes its translocation to centrosomes, which may stimulate centrosome maturation. A chromosomal deletion including this gene may be associated with myeloid leukemia and myelodysplastic syndrome in human patients. [provided by RefSeq, Oct 2016]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Alox12b G A 11: 69,169,616 R666H possibly damaging Het
Atp9a T C 2: 168,649,615 T677A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
C9 A G 15: 6,491,484 D470G probably damaging Het
Camsap2 A G 1: 136,287,963 F337L probably damaging Het
Cep152 G A 2: 125,613,047 R278W probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Chfr G A 5: 110,136,168 R36H probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Drp2 A T X: 134,435,135 probably benign Het
Dzip3 A G 16: 48,943,455 probably null Het
Emb A T 13: 117,268,930 D296V probably damaging Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gm6177 A T 1: 160,893,171 noncoding transcript Het
Iqsec1 A G 6: 90,694,606 S194P probably damaging Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnmb2 A G 3: 32,156,102 probably null Het
Nbeal1 A T 1: 60,289,946 K2174N possibly damaging Het
Ncapg G A 5: 45,678,455 M409I probably benign Het
Ocstamp A G 2: 165,397,313 S318P possibly damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Pom121l2 T C 13: 21,982,239 S227P probably benign Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Sptbn5 A G 2: 120,065,994 C729R probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tfap4 A G 16: 4,551,999 I4T probably damaging Het
Thrb C A 14: 18,030,275 Q340K probably damaging Het
Tnc T C 4: 63,970,351 Y1735C probably damaging Het
Ubr1 A T 2: 120,895,066 probably null Het
Other mutations in Hepacam2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01937:Hepacam2 APN 6 3487117 missense probably benign 0.07
IGL01945:Hepacam2 APN 6 3487117 missense probably benign 0.07
IGL02254:Hepacam2 APN 6 3483421 missense probably benign 0.06
IGL02445:Hepacam2 APN 6 3483481 missense probably damaging 1.00
IGL02546:Hepacam2 APN 6 3483568 missense possibly damaging 0.93
IGL02620:Hepacam2 APN 6 3487280 splice site probably benign
IGL02697:Hepacam2 APN 6 3476036 missense possibly damaging 0.79
R0089:Hepacam2 UTSW 6 3487094 missense probably damaging 0.96
R0208:Hepacam2 UTSW 6 3467505 splice site probably benign
R0230:Hepacam2 UTSW 6 3463336 missense probably benign 0.01
R0299:Hepacam2 UTSW 6 3476121 missense probably damaging 1.00
R0499:Hepacam2 UTSW 6 3476121 missense probably damaging 1.00
R0608:Hepacam2 UTSW 6 3483479 missense possibly damaging 0.93
R1350:Hepacam2 UTSW 6 3467530 nonsense probably null
R1663:Hepacam2 UTSW 6 3483439 missense possibly damaging 0.76
R1749:Hepacam2 UTSW 6 3483379 missense probably damaging 1.00
R1997:Hepacam2 UTSW 6 3487241 missense probably damaging 1.00
R2146:Hepacam2 UTSW 6 3463378 splice site probably benign
R3911:Hepacam2 UTSW 6 3494477 start codon destroyed probably null 0.98
R4281:Hepacam2 UTSW 6 3475938 missense probably damaging 0.98
R4290:Hepacam2 UTSW 6 3487237 missense probably benign 0.01
R4794:Hepacam2 UTSW 6 3475933 missense probably damaging 0.96
R4890:Hepacam2 UTSW 6 3487231 missense probably damaging 0.96
R5330:Hepacam2 UTSW 6 3483377 missense probably benign 0.00
R5331:Hepacam2 UTSW 6 3483377 missense probably benign 0.00
R5677:Hepacam2 UTSW 6 3466142 missense probably damaging 1.00
R5796:Hepacam2 UTSW 6 3466200 unclassified probably null
R5844:Hepacam2 UTSW 6 3476073 missense probably damaging 0.99
R5979:Hepacam2 UTSW 6 3476149 missense probably damaging 1.00
R6017:Hepacam2 UTSW 6 3483332 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGATGCAGGCTTTGAGAATTAC -3'
(R):5'- CAGTGCACTATGGCTTCCAC -3'

Sequencing Primer
(F):5'- CTTAATTCCTTCACAGTGGCAAGAGC -3'
(R):5'- TCTGACATCCAGATCATATGGCTG -3'
Posted On2015-07-06