Incidental Mutation 'R4371:Phactr2'
ID326001
Institutional Source Beutler Lab
Gene Symbol Phactr2
Ensembl Gene ENSMUSG00000062866
Gene Namephosphatase and actin regulator 2
Synonyms
MMRRC Submission 041117-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4371 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location13207717-13474412 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 13253820 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 235 (S235P)
Ref Sequence ENSEMBL: ENSMUSP00000101184 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000079698] [ENSMUST00000105543] [ENSMUST00000105545] [ENSMUST00000105546]
Predicted Effect probably damaging
Transcript: ENSMUST00000079698
AA Change: S165P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000078637
Gene: ENSMUSG00000062866
AA Change: S165P

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 154 179 N/A INTRINSIC
low complexity region 208 218 N/A INTRINSIC
low complexity region 250 270 N/A INTRINSIC
low complexity region 378 388 N/A INTRINSIC
RPEL 403 428 5.81e-8 SMART
RPEL 441 466 1.36e-8 SMART
RPEL 479 504 1.64e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105543
AA Change: S172P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101182
Gene: ENSMUSG00000062866
AA Change: S172P

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 165 190 N/A INTRINSIC
low complexity region 219 229 N/A INTRINSIC
low complexity region 261 281 N/A INTRINSIC
low complexity region 389 399 N/A INTRINSIC
RPEL 414 439 5.81e-8 SMART
RPEL 452 477 1.36e-8 SMART
RPEL 490 515 1.64e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105545
AA Change: S235P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101184
Gene: ENSMUSG00000062866
AA Change: S235P

DomainStartEndE-ValueType
low complexity region 50 65 N/A INTRINSIC
RPEL 71 96 7.44e-6 SMART
low complexity region 157 182 N/A INTRINSIC
low complexity region 211 221 N/A INTRINSIC
low complexity region 253 273 N/A INTRINSIC
low complexity region 381 391 N/A INTRINSIC
RPEL 406 431 5.81e-8 SMART
RPEL 444 469 1.36e-8 SMART
RPEL 482 507 1.64e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105546
AA Change: S241P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101185
Gene: ENSMUSG00000062866
AA Change: S241P

DomainStartEndE-ValueType
low complexity region 39 54 N/A INTRINSIC
RPEL 60 85 7.44e-6 SMART
low complexity region 133 144 N/A INTRINSIC
low complexity region 149 184 N/A INTRINSIC
low complexity region 199 213 N/A INTRINSIC
low complexity region 226 251 N/A INTRINSIC
low complexity region 280 290 N/A INTRINSIC
low complexity region 322 342 N/A INTRINSIC
low complexity region 450 460 N/A INTRINSIC
RPEL 475 500 5.81e-8 SMART
RPEL 513 538 1.36e-8 SMART
RPEL 551 576 1.64e-7 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105547
AA Change: S239P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101186
Gene: ENSMUSG00000062866
AA Change: S239P

DomainStartEndE-ValueType
low complexity region 12 36 N/A INTRINSIC
low complexity region 50 65 N/A INTRINSIC
low complexity region 109 124 N/A INTRINSIC
RPEL 130 155 7.44e-6 SMART
low complexity region 224 249 N/A INTRINSIC
low complexity region 278 288 N/A INTRINSIC
low complexity region 320 340 N/A INTRINSIC
low complexity region 448 458 N/A INTRINSIC
RPEL 473 498 5.81e-8 SMART
RPEL 511 536 1.36e-8 SMART
RPEL 549 574 1.64e-7 SMART
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Alox12b G A 11: 69,169,616 R666H possibly damaging Het
Atp9a T C 2: 168,649,615 T677A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
C9 A G 15: 6,491,484 D470G probably damaging Het
Camsap2 A G 1: 136,287,963 F337L probably damaging Het
Cep152 G A 2: 125,613,047 R278W probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Chfr G A 5: 110,136,168 R36H probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Drp2 A T X: 134,435,135 probably benign Het
Dzip3 A G 16: 48,943,455 probably null Het
Emb A T 13: 117,268,930 D296V probably damaging Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gm6177 A T 1: 160,893,171 noncoding transcript Het
Hepacam2 A T 6: 3,486,988 V123E probably damaging Het
Iqsec1 A G 6: 90,694,606 S194P probably damaging Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnmb2 A G 3: 32,156,102 probably null Het
Nbeal1 A T 1: 60,289,946 K2174N possibly damaging Het
Ncapg G A 5: 45,678,455 M409I probably benign Het
Ocstamp A G 2: 165,397,313 S318P possibly damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Pom121l2 T C 13: 21,982,239 S227P probably benign Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Sptbn5 A G 2: 120,065,994 C729R probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tfap4 A G 16: 4,551,999 I4T probably damaging Het
Thrb C A 14: 18,030,275 Q340K probably damaging Het
Tnc T C 4: 63,970,351 Y1735C probably damaging Het
Ubr1 A T 2: 120,895,066 probably null Het
Other mutations in Phactr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00335:Phactr2 APN 10 13245535 missense probably damaging 1.00
IGL01844:Phactr2 APN 10 13253437 missense probably benign 0.05
IGL01893:Phactr2 APN 10 13247188 missense probably benign 0.38
IGL02458:Phactr2 APN 10 13261828 missense probably damaging 1.00
IGL02612:Phactr2 APN 10 13245423 missense probably damaging 0.99
IGL02620:Phactr2 APN 10 13291888 missense probably damaging 1.00
IGL03064:Phactr2 APN 10 13388713 utr 5 prime probably benign
IGL03493:Phactr2 APN 10 13257669 missense probably benign 0.02
R0973:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R0973:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R0974:Phactr2 UTSW 10 13247139 missense possibly damaging 0.88
R1480:Phactr2 UTSW 10 13253792 missense possibly damaging 0.74
R3115:Phactr2 UTSW 10 13261901 nonsense probably null
R3116:Phactr2 UTSW 10 13261901 nonsense probably null
R3713:Phactr2 UTSW 10 13388732 start gained probably benign
R4367:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R4368:Phactr2 UTSW 10 13253820 missense probably damaging 1.00
R5344:Phactr2 UTSW 10 13253616 missense possibly damaging 0.76
R5491:Phactr2 UTSW 10 13261846 missense possibly damaging 0.91
R5617:Phactr2 UTSW 10 13474065 missense possibly damaging 0.60
R5656:Phactr2 UTSW 10 13388703 missense probably benign 0.34
R5895:Phactr2 UTSW 10 13245517 missense probably damaging 1.00
R6051:Phactr2 UTSW 10 13261811 unclassified probably null 0.00
R6317:Phactr2 UTSW 10 13261882 missense probably damaging 0.98
R7048:Phactr2 UTSW 10 13245424 missense probably benign 0.28
R7101:Phactr2 UTSW 10 13247178 missense probably benign 0.00
R7221:Phactr2 UTSW 10 13247039 missense possibly damaging 0.58
X0026:Phactr2 UTSW 10 13257634 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCTGAGAGCTCTCCCTTAAG -3'
(R):5'- TGCTGCCTCTCACATTCGAG -3'

Sequencing Primer
(F):5'- TGAGAGCTCTCCCTTAAGACTAGG -3'
(R):5'- TCTCACATTCGAGGCGTG -3'
Posted On2015-07-06