Incidental Mutation 'R4371:Dzip3'
ID326009
Institutional Source Beutler Lab
Gene Symbol Dzip3
Ensembl Gene ENSMUSG00000064061
Gene NameDAZ interacting protein 3, zinc finger
Synonyms2A-HUB, 6430549P11Rik, 2310047C04Rik
MMRRC Submission 041117-MU
Accession Numbers

Genbank: NM_001110017.1, NM_027341.2; Ensembl: ENSMUST00000121869

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4371 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location48924232-48994165 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 48943455 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000113344 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000114516] [ENSMUST00000121869]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000083733
Predicted Effect probably null
Transcript: ENSMUST00000114516
SMART Domains Protein: ENSMUSP00000110161
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 451 472 N/A INTRINSIC
coiled coil region 548 568 N/A INTRINSIC
coiled coil region 599 650 N/A INTRINSIC
low complexity region 743 754 N/A INTRINSIC
low complexity region 883 891 N/A INTRINSIC
RING 938 977 2.09e-7 SMART
Predicted Effect probably null
Transcript: ENSMUST00000121869
SMART Domains Protein: ENSMUSP00000113344
Gene: ENSMUSG00000064061

DomainStartEndE-ValueType
low complexity region 657 678 N/A INTRINSIC
coiled coil region 754 774 N/A INTRINSIC
coiled coil region 805 856 N/A INTRINSIC
low complexity region 949 960 N/A INTRINSIC
low complexity region 1089 1097 N/A INTRINSIC
RING 1144 1183 2.09e-7 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133377
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139350
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147358
Meta Mutation Damage Score 0.594 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-indcued allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Gene trapped(23)

Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Alox12b G A 11: 69,169,616 R666H possibly damaging Het
Atp9a T C 2: 168,649,615 T677A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
C9 A G 15: 6,491,484 D470G probably damaging Het
Camsap2 A G 1: 136,287,963 F337L probably damaging Het
Cep152 G A 2: 125,613,047 R278W probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Chfr G A 5: 110,136,168 R36H probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Drp2 A T X: 134,435,135 probably benign Het
Emb A T 13: 117,268,930 D296V probably damaging Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gm6177 A T 1: 160,893,171 noncoding transcript Het
Hepacam2 A T 6: 3,486,988 V123E probably damaging Het
Iqsec1 A G 6: 90,694,606 S194P probably damaging Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnmb2 A G 3: 32,156,102 probably null Het
Nbeal1 A T 1: 60,289,946 K2174N possibly damaging Het
Ncapg G A 5: 45,678,455 M409I probably benign Het
Ocstamp A G 2: 165,397,313 S318P possibly damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Pom121l2 T C 13: 21,982,239 S227P probably benign Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Sptbn5 A G 2: 120,065,994 C729R probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tfap4 A G 16: 4,551,999 I4T probably damaging Het
Thrb C A 14: 18,030,275 Q340K probably damaging Het
Tnc T C 4: 63,970,351 Y1735C probably damaging Het
Ubr1 A T 2: 120,895,066 probably null Het
Other mutations in Dzip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00825:Dzip3 APN 16 48928415 missense probably damaging 1.00
IGL00931:Dzip3 APN 16 48935497 critical splice donor site probably null
IGL01109:Dzip3 APN 16 48929674 missense probably benign 0.27
IGL01121:Dzip3 APN 16 48944881 missense probably benign 0.10
IGL01328:Dzip3 APN 16 48972258 missense probably damaging 1.00
IGL01729:Dzip3 APN 16 48928363 missense possibly damaging 0.78
IGL02044:Dzip3 APN 16 48948427 missense possibly damaging 0.90
IGL02051:Dzip3 APN 16 48972254 missense probably benign 0.01
IGL02115:Dzip3 APN 16 48948485 missense probably benign 0.00
IGL02125:Dzip3 APN 16 48927596 missense probably damaging 1.00
IGL02136:Dzip3 APN 16 48927582 missense possibly damaging 0.94
IGL02244:Dzip3 APN 16 48980988 missense probably benign 0.01
IGL02253:Dzip3 APN 16 48944924 missense probably benign 0.34
IGL02412:Dzip3 APN 16 48958457 missense probably benign 0.00
IGL02452:Dzip3 APN 16 48938537 splice site probably benign
IGL02481:Dzip3 APN 16 48975551 splice site probably benign
IGL02499:Dzip3 APN 16 48933850 missense probably damaging 1.00
IGL02511:Dzip3 APN 16 48936980 missense possibly damaging 0.75
IGL02519:Dzip3 APN 16 48928396 missense probably damaging 1.00
IGL02610:Dzip3 APN 16 48951653 missense probably damaging 1.00
IGL03129:Dzip3 APN 16 48942083 missense possibly damaging 0.51
IGL03342:Dzip3 APN 16 48929623 missense probably damaging 0.98
IGL03493:Dzip3 APN 16 48951696 missense probably benign 0.32
dazwick UTSW 16 48958465 missense possibly damaging 0.90
1mM(1):Dzip3 UTSW 16 48951557 missense probably damaging 1.00
PIT4651001:Dzip3 UTSW 16 48944878 missense probably benign
R0313:Dzip3 UTSW 16 48937061 missense probably damaging 0.99
R0483:Dzip3 UTSW 16 48947713 missense possibly damaging 0.94
R0504:Dzip3 UTSW 16 48959643 splice site probably benign
R0744:Dzip3 UTSW 16 48959675 missense probably damaging 1.00
R0800:Dzip3 UTSW 16 48953808 splice site probably benign
R0927:Dzip3 UTSW 16 48975477 missense probably damaging 0.99
R0931:Dzip3 UTSW 16 48951558 missense probably damaging 1.00
R1170:Dzip3 UTSW 16 48961208 missense probably damaging 1.00
R1203:Dzip3 UTSW 16 48951817 missense probably damaging 1.00
R1205:Dzip3 UTSW 16 48951681 missense probably damaging 1.00
R1442:Dzip3 UTSW 16 48945622 missense probably benign 0.19
R1526:Dzip3 UTSW 16 48937006 missense probably damaging 1.00
R1560:Dzip3 UTSW 16 48951540 splice site probably null
R1585:Dzip3 UTSW 16 48977878 splice site probably benign
R1682:Dzip3 UTSW 16 48958417 critical splice donor site probably null
R1957:Dzip3 UTSW 16 48927593 missense probably damaging 1.00
R2472:Dzip3 UTSW 16 48953787 missense possibly damaging 0.85
R2571:Dzip3 UTSW 16 48972218 splice site probably null
R3040:Dzip3 UTSW 16 48928324 missense probably damaging 1.00
R3081:Dzip3 UTSW 16 48927558 missense probably damaging 1.00
R3615:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3616:Dzip3 UTSW 16 48937063 missense probably damaging 1.00
R3786:Dzip3 UTSW 16 48975543 missense probably benign 0.08
R3851:Dzip3 UTSW 16 48950013 missense possibly damaging 0.94
R4097:Dzip3 UTSW 16 48958489 nonsense probably null
R4612:Dzip3 UTSW 16 48952040 nonsense probably null
R4671:Dzip3 UTSW 16 48979590 nonsense probably null
R4695:Dzip3 UTSW 16 48951561 missense probably damaging 1.00
R4696:Dzip3 UTSW 16 48925969 unclassified probably benign
R4769:Dzip3 UTSW 16 48938474 missense probably damaging 0.97
R5063:Dzip3 UTSW 16 48953754 nonsense probably null
R5321:Dzip3 UTSW 16 48957675 missense possibly damaging 0.95
R5764:Dzip3 UTSW 16 48927361 intron probably benign
R6020:Dzip3 UTSW 16 48951842 missense probably damaging 1.00
R6218:Dzip3 UTSW 16 48958465 missense possibly damaging 0.90
R6300:Dzip3 UTSW 16 48951807 missense probably damaging 1.00
R6365:Dzip3 UTSW 16 48931273 missense probably damaging 0.96
R6778:Dzip3 UTSW 16 48982083 missense probably benign 0.00
R6915:Dzip3 UTSW 16 48942125 missense possibly damaging 0.72
R7047:Dzip3 UTSW 16 48982126 missense probably benign 0.04
R7059:Dzip3 UTSW 16 48980942 missense probably benign 0.34
R7095:Dzip3 UTSW 16 48927790 missense probably benign
R7227:Dzip3 UTSW 16 48951569 missense probably damaging 0.99
R7319:Dzip3 UTSW 16 48927540 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- GAAGCCCACCCGTTTTCCTAT -3'
(R):5'- GGCAACTTTGTATACAGCAGAAAGC -3'

Sequencing Primer
(F):5'- AATGCAGCTCTCTCTATGGTAAGG -3'
(R):5'- CGTTTGCTTAAGGGCTCA -3'
Posted On2015-07-06