Incidental Mutation 'R4371:Drp2'
ID326014
Institutional Source Beutler Lab
Gene Symbol Drp2
Ensembl Gene ENSMUSG00000000223
Gene Namedystrophin related protein 2
Synonyms
MMRRC Submission 041117-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R4371 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location134404551-134456573 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) A to T at 134435135 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000115246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113224] [ENSMUST00000113226] [ENSMUST00000113228] [ENSMUST00000153424]
Predicted Effect noncoding transcript
Transcript: ENSMUST00000000228
Predicted Effect probably benign
Transcript: ENSMUST00000113224
SMART Domains Protein: ENSMUSP00000108850
Gene: ENSMUSG00000000223

DomainStartEndE-ValueType
SPEC 129 251 5e-7 SMART
SPEC 258 360 6.4e-7 SMART
WW 377 409 4.6e-10 SMART
Pfam:EF-hand_2 410 528 9.5e-36 PFAM
Pfam:EF-hand_3 532 623 9.1e-35 PFAM
ZnF_ZZ 628 673 1e-17 SMART
coiled coil region 800 900 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113226
SMART Domains Protein: ENSMUSP00000108852
Gene: ENSMUSG00000000223

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000113228
SMART Domains Protein: ENSMUSP00000108854
Gene: ENSMUSG00000000223

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142146
Predicted Effect probably benign
Transcript: ENSMUST00000153424
SMART Domains Protein: ENSMUSP00000115246
Gene: ENSMUSG00000000223

DomainStartEndE-ValueType
SPEC 105 227 7.58e-5 SMART
SPEC 234 336 1e-4 SMART
WW 353 385 8.03e-8 SMART
Pfam:EF-hand_3 508 599 2e-35 PFAM
ZnF_ZZ 604 649 2.03e-15 SMART
coiled coil region 776 876 N/A INTRINSIC
Meta Mutation Damage Score 0.0608 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Members of the dystrophin family of proteins perform a critical role in the maintenance of membrane-associated complexes at points of intercellular contact in vertebrate cells. The protein encoded by this gene is predicted to resemble certain short C-terminal isoforms of dystrophin and dystrophin-related protein 1 (DRP1 or utrophin). DRP2 is expressed principally in the brain and spinal cord. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jan 2010]
PHENOTYPE: Mice homozygous for a conditional allele activated in peripheral nerves exhibit abnormal Scwann cell morphology, supernumerary Schwann cell, abnormal myelin sheath morphology and hypermyelination. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alg11 C A 8: 22,068,079 A469E probably benign Het
Alox12b G A 11: 69,169,616 R666H possibly damaging Het
Atp9a T C 2: 168,649,615 T677A probably damaging Het
B4galt3 C A 1: 171,274,043 H196N probably damaging Het
Bckdk C T 7: 127,906,419 A238V probably benign Het
Brpf3 C T 17: 28,836,620 A1181V probably damaging Het
C9 A G 15: 6,491,484 D470G probably damaging Het
Camsap2 A G 1: 136,287,963 F337L probably damaging Het
Cep152 G A 2: 125,613,047 R278W probably damaging Het
Cfb T C 17: 34,860,314 K287R probably damaging Het
Chfr G A 5: 110,136,168 R36H probably damaging Het
Cyp4f14 T C 17: 32,909,258 N261S probably benign Het
Dzip3 A G 16: 48,943,455 probably null Het
Emb A T 13: 117,268,930 D296V probably damaging Het
Epha1 T C 6: 42,365,457 Y319C probably damaging Het
Flcn C T 11: 59,803,784 V121I possibly damaging Het
Glrp1 GTGCTGCTGCTGCTGCTGCTGCTGCTG GTGCTGCTGCTGCTGCTGCTGCTGCTGCTG 1: 88,503,275 probably benign Het
Gm6177 A T 1: 160,893,171 noncoding transcript Het
Hepacam2 A T 6: 3,486,988 V123E probably damaging Het
Iqsec1 A G 6: 90,694,606 S194P probably damaging Het
Kat6a T C 8: 22,911,929 I438T possibly damaging Het
Kcnmb2 A G 3: 32,156,102 probably null Het
Nbeal1 A T 1: 60,289,946 K2174N possibly damaging Het
Ncapg G A 5: 45,678,455 M409I probably benign Het
Ocstamp A G 2: 165,397,313 S318P possibly damaging Het
Olfr507 C T 7: 108,621,889 L26F probably benign Het
Phactr2 A G 10: 13,253,820 S235P probably damaging Het
Pom121l2 T C 13: 21,982,239 S227P probably benign Het
Sdf2 C T 11: 78,251,037 T66I probably damaging Het
Sptbn5 A G 2: 120,065,994 C729R probably damaging Het
Sys1 T C 2: 164,461,395 W10R probably damaging Het
Tfap4 A G 16: 4,551,999 I4T probably damaging Het
Thrb C A 14: 18,030,275 Q340K probably damaging Het
Tnc T C 4: 63,970,351 Y1735C probably damaging Het
Ubr1 A T 2: 120,895,066 probably null Het
Other mutations in Drp2
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1119:Drp2 UTSW X 134441322 missense probably damaging 1.00
R1864:Drp2 UTSW X 134427115 missense probably benign 0.03
R3618:Drp2 UTSW X 134439968 missense probably benign 0.13
R4367:Drp2 UTSW X 134435135 intron probably benign
R4993:Drp2 UTSW X 134441316 missense probably damaging 0.99
R4994:Drp2 UTSW X 134441316 missense probably damaging 0.99
R4996:Drp2 UTSW X 134441316 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGACCACAGATGATATTGGAGCAG -3'
(R):5'- AGCTCTTAGGCTGAAGCAC -3'

Sequencing Primer
(F):5'- CTGCCTTGTAAGAGAGCTCAG -3'
(R):5'- ACAGTTGCTCTCTGACCGG -3'
Posted On2015-07-06