Incidental Mutation 'R4384:Gad2'
ID326094
Institutional Source Beutler Lab
Gene Symbol Gad2
Ensembl Gene ENSMUSG00000026787
Gene Nameglutamic acid decarboxylase 2
SynonymsGad-2, 6330404F12Rik, GAD(65), GAD65
MMRRC Submission 042002-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4384 (G1)
Quality Score225
Status Validated
Chromosome2
Chromosomal Location22622205-22693874 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 22685410 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 509 (V509I)
Ref Sequence ENSEMBL: ENSMUSP00000028123 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028123]
Predicted Effect probably benign
Transcript: ENSMUST00000028123
AA Change: V509I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000028123
Gene: ENSMUSG00000026787
AA Change: V509I

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 138 509 7.8e-138 PFAM
Meta Mutation Damage Score 0.1224 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.0%
  • 20x: 94.4%
Validation Efficiency 97% (56/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of several forms of glutamic acid decarboxylase, identified as a major autoantigen in insulin-dependent diabetes. The enzyme encoded is responsible for catalyzing the production of gamma-aminobutyric acid from L-glutamic acid. A pathogenic role for this enzyme has been identified in the human pancreas since it has been identified as an autoantibody and an autoreactive T cell target in insulin-dependent diabetes. This gene may also play a role in the stiff man syndrome. Alternative splicing results in multiple transcript variants that encode the same protein. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit spontaneous (frequently fatal) seizures, increased anxiety-like behavior, and reduced intermale aggression. Heterozygotes show reduced aggressiveness. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acer2 T A 4: 86,874,568 V27E possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Brip1 A T 11: 86,148,429 D426E possibly damaging Het
Cadps2 T A 6: 23,412,988 Q654L probably benign Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cntnap3 A G 13: 64,748,460 Y1067H probably damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Ddias G A 7: 92,858,223 T828I probably damaging Het
Dennd4c A G 4: 86,811,450 Y763C probably damaging Het
Dscam T A 16: 96,709,216 I948F probably damaging Het
E030018B13Rik A G 7: 63,919,393 probably benign Het
E2f8 G A 7: 48,867,099 T844I possibly damaging Het
Eps8 T A 6: 137,499,592 H603L probably benign Het
Esrrg G A 1: 188,043,711 C122Y probably damaging Het
Frmd4a C T 2: 4,594,563 R467* probably null Het
Gpat4 A G 8: 23,174,586 I446T probably benign Het
Klhl12 T G 1: 134,487,654 D435E probably damaging Het
Luc7l T C 17: 26,279,962 probably benign Het
March2 C A 17: 33,696,193 M142I probably benign Het
Marf1 T A 16: 14,142,641 Y513F possibly damaging Het
Mdm2 T C 10: 117,696,439 D114G possibly damaging Het
Med1 G A 11: 98,152,862 probably benign Het
Meikin C T 11: 54,417,787 Q404* probably null Het
Myh9 A T 15: 77,791,712 probably benign Het
Mylip T C 13: 45,389,958 M1T probably null Het
Ncapg2 T C 12: 116,439,877 probably null Het
Nmd3 T C 3: 69,724,398 probably benign Het
Nwd2 T A 5: 63,806,571 L1166H probably damaging Het
Olfr341 A G 2: 36,479,998 L44P probably damaging Het
Olfr912 T C 9: 38,582,053 Y259H probably damaging Het
Rubcn A G 16: 32,856,902 I71T probably damaging Het
Rwdd3 T C 3: 121,158,757 probably benign Het
Ryr2 T C 13: 11,605,233 E3826G probably damaging Het
Sdad1 T C 5: 92,298,257 Q273R probably benign Het
Sdha A T 13: 74,326,985 I579K possibly damaging Het
Sema4d A G 13: 51,702,883 L771P probably damaging Het
Shroom3 G T 5: 92,943,086 V1151F probably damaging Het
Slc6a11 A G 6: 114,247,727 E624G possibly damaging Het
Tada3 G T 6: 113,370,379 R117S probably damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Trpc1 C A 9: 95,732,108 M34I probably benign Het
Trpc4ap A G 2: 155,640,507 V521A possibly damaging Het
Trpm2 A G 10: 77,917,725 V1315A probably benign Het
Tvp23a A G 16: 10,428,682 S80P probably benign Het
Usp54 A T 14: 20,550,085 probably null Het
Vmn2r27 A G 6: 124,224,156 Y281H probably benign Het
Vwf T A 6: 125,655,116 I37N unknown Het
Zfp329 G A 7: 12,811,657 probably benign Het
Zfp616 G T 11: 74,083,179 L91F possibly damaging Het
Other mutations in Gad2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Gad2 APN 2 22685386 missense probably benign 0.07
IGL00870:Gad2 APN 2 22629971 missense probably benign 0.42
IGL01142:Gad2 APN 2 22681285 splice site probably benign
IGL01577:Gad2 APN 2 22681280 splice site probably benign
IGL01671:Gad2 APN 2 22623699 nonsense probably null
IGL02346:Gad2 APN 2 22629939 splice site probably benign
IGL02348:Gad2 APN 2 22629393 missense probably damaging 1.00
IGL03113:Gad2 APN 2 22681355 missense probably benign 0.09
gruene UTSW 2 22685067 critical splice donor site probably null
mosey UTSW 2 22668257 missense probably damaging 1.00
R0630:Gad2 UTSW 2 22690336 missense probably benign 0.14
R1109:Gad2 UTSW 2 22681394 missense probably damaging 1.00
R1109:Gad2 UTSW 2 22690159 splice site probably benign
R1122:Gad2 UTSW 2 22623451 missense possibly damaging 0.68
R1604:Gad2 UTSW 2 22623840 critical splice donor site probably null
R1773:Gad2 UTSW 2 22690207 missense probably benign
R1895:Gad2 UTSW 2 22685428 missense probably benign
R1946:Gad2 UTSW 2 22685428 missense probably benign
R2329:Gad2 UTSW 2 22668289 missense probably damaging 1.00
R2857:Gad2 UTSW 2 22673975 missense probably benign 0.02
R3754:Gad2 UTSW 2 22681340 missense possibly damaging 0.91
R3847:Gad2 UTSW 2 22684988 missense probably benign 0.00
R4382:Gad2 UTSW 2 22685410 missense probably benign
R4383:Gad2 UTSW 2 22685410 missense probably benign
R4651:Gad2 UTSW 2 22668362 missense probably damaging 1.00
R4700:Gad2 UTSW 2 22673970 missense probably damaging 1.00
R4766:Gad2 UTSW 2 22622667 missense probably damaging 0.99
R5279:Gad2 UTSW 2 22673957 missense probably benign 0.38
R5372:Gad2 UTSW 2 22690243 missense possibly damaging 0.84
R5505:Gad2 UTSW 2 22624833 missense probably benign
R5820:Gad2 UTSW 2 22690249 missense probably benign 0.00
R5868:Gad2 UTSW 2 22685067 critical splice donor site probably null
R6026:Gad2 UTSW 2 22623736 missense probably benign 0.00
R6497:Gad2 UTSW 2 22668257 missense probably damaging 1.00
R6675:Gad2 UTSW 2 22673985 missense possibly damaging 0.67
X0019:Gad2 UTSW 2 22690172 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- CTGGGATAAAGAGTGGACTCAC -3'
(R):5'- AGGGGACAATGGCTTTGCAC -3'

Sequencing Primer
(F):5'- TGGACTCACAACTCTGAAGAATGTG -3'
(R):5'- ACAATGGCTTTGCACATCTGG -3'
Posted On2015-07-06