Incidental Mutation 'R4385:Ptpn13'
ID326157
Institutional Source Beutler Lab
Gene Symbol Ptpn13
Ensembl Gene ENSMUSG00000034573
Gene Nameprotein tyrosine phosphatase, non-receptor type 13
SynonymsPTPL1, Ptpri, PTP-BL
MMRRC Submission 041124-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.364) question?
Stock #R4385 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location103425192-103598303 bp(+) (GRCm38)
Type of Mutationsplice site (6 bp from exon)
DNA Base Change (assembly) T to C at 103533407 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000048119 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048957] [ENSMUST00000196014]
Predicted Effect probably null
Transcript: ENSMUST00000048957
SMART Domains Protein: ENSMUSP00000048119
Gene: ENSMUSG00000034573

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Blast:B41 340 447 6e-34 BLAST
coiled coil region 460 487 N/A INTRINSIC
B41 561 774 3.3e-68 SMART
FERM_C 780 869 3.2e-35 SMART
low complexity region 1049 1058 N/A INTRINSIC
PDZ 1093 1170 7.6e-25 SMART
low complexity region 1224 1236 N/A INTRINSIC
low complexity region 1309 1322 N/A INTRINSIC
low complexity region 1331 1341 N/A INTRINSIC
PDZ 1365 1442 1.7e-24 SMART
low complexity region 1450 1468 N/A INTRINSIC
PDZ 1499 1579 3.5e-19 SMART
PDZ 1773 1845 1.2e-21 SMART
PDZ 1867 1942 1.6e-16 SMART
low complexity region 2123 2134 N/A INTRINSIC
PTPc 2179 2436 6.9e-113 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000196014
SMART Domains Protein: ENSMUSP00000143571
Gene: ENSMUSG00000034573

DomainStartEndE-ValueType
KIND 3 190 2.3e-80 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000197715
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199412
Predicted Effect noncoding transcript
Transcript: ENSMUST00000200581
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the protein tyrosine phosphatase (PTP) family. PTPs are signaling molecules that regulate a variety of cellular processes including cell growth, differentiation, mitotic cycle, and oncogenic transformation. This PTP is a large intracellular protein. It has a catalytic PTP domain at its C-terminus and two major structural domains: a region with five PDZ domains and a FERM domain that binds to plasma membrane and cytoskeletal elements. This PTP was found to interact with, and dephosphorylate, Fas receptor and IkappaBalpha through the PDZ domains. This suggests it has a role in Fas mediated programmed cell death. This PTP was also shown to interact with GTPase-activating protein, and thus may function as a regulator of Rho signaling pathways. Four alternatively spliced transcript variants, which encode distinct proteins, have been reported. [provided by RefSeq, Oct 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit abnormal T-helper cell differentiation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,208 S251P possibly damaging Het
A530032D15Rik C T 1: 85,109,336 probably null Het
Abcc3 A T 11: 94,368,239 I426N probably damaging Het
Abcc6 C T 7: 45,995,328 V808I possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Apbb1 A G 7: 105,567,276 S140P probably benign Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cdc27 T C 11: 104,534,814 R59G probably benign Het
Cfap43 T C 19: 47,797,129 R441G probably benign Het
Chsy3 A G 18: 59,176,352 I226V probably benign Het
Chsy3 A T 18: 59,179,474 T340S possibly damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Col5a1 A C 2: 28,024,779 M136L probably damaging Het
Coro2a A T 4: 46,541,961 I387N possibly damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Cyfip2 C T 11: 46,242,403 M823I probably benign Het
Dcbld2 A G 16: 58,463,066 K555E probably damaging Het
Dpep3 A G 8: 105,978,186 M164T probably damaging Het
Flg C A 3: 93,293,009 probably benign Het
Gm13089 C T 4: 143,698,014 probably null Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Ift172 T C 5: 31,286,967 D37G probably damaging Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk1 A T 7: 44,228,569 D83V probably benign Het
Klk9 T C 7: 43,794,275 V71A probably benign Het
Loxhd1 A G 18: 77,372,911 K806R probably damaging Het
Metap1 T C 3: 138,475,063 E119G possibly damaging Het
Nbea T C 3: 56,000,638 H1351R possibly damaging Het
Nim1k T C 13: 119,712,626 D244G probably damaging Het
Npas1 C T 7: 16,459,185 probably null Het
Pcdh15 A G 10: 74,550,490 D1136G probably damaging Het
Pde6b A G 5: 108,427,642 I657V probably benign Het
Pi4ka A G 16: 17,386,265 V55A probably benign Het
Plxnb2 T C 15: 89,160,623 N1173S probably damaging Het
Ptprb A G 10: 116,346,867 S1483G probably benign Het
Rbm48 G A 5: 3,590,300 P360S probably damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rfpl4 A G 7: 5,110,670 S165P possibly damaging Het
Scn9a A T 2: 66,484,556 L1595Q probably damaging Het
Scp2 A T 4: 108,071,350 V381D probably damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Slc30a9 T C 5: 67,315,767 Y65H probably damaging Het
Sorcs1 A G 19: 50,190,161 I841T probably benign Het
Spag7 C T 11: 70,669,203 A27T probably damaging Het
St6galnac6 A G 2: 32,615,024 I181V possibly damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Ugt3a1 C T 15: 9,306,479 S238F probably benign Het
Usp9y G A Y: 1,304,756 L2363F probably damaging Het
Vmn1r34 T A 6: 66,637,139 H205L probably damaging Het
Vps50 C A 6: 3,516,694 Q59K probably benign Het
Zeb2 T A 2: 45,023,062 D39V probably damaging Het
Zfp146 G A 7: 30,162,422 T65I probably benign Het
Zfp36 T C 7: 28,377,691 D264G probably benign Het
Other mutations in Ptpn13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00340:Ptpn13 APN 5 103551058 missense probably damaging 1.00
IGL00569:Ptpn13 APN 5 103591006 splice site probably benign
IGL00764:Ptpn13 APN 5 103597718 missense probably damaging 1.00
IGL00805:Ptpn13 APN 5 103554729 missense probably benign 0.33
IGL00922:Ptpn13 APN 5 103588088 missense probably damaging 1.00
IGL00959:Ptpn13 APN 5 103517571 critical splice donor site probably null
IGL01090:Ptpn13 APN 5 103541314 missense probably null 0.80
IGL01352:Ptpn13 APN 5 103486775 splice site probably null
IGL01510:Ptpn13 APN 5 103562300 missense probably damaging 1.00
IGL01515:Ptpn13 APN 5 103556113 missense probably benign 0.06
IGL01896:Ptpn13 APN 5 103501523 missense possibly damaging 0.78
IGL02094:Ptpn13 APN 5 103594617 missense probably damaging 1.00
IGL02561:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02562:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02567:Ptpn13 APN 5 103562291 missense probably damaging 1.00
IGL02604:Ptpn13 APN 5 103501903 missense probably benign 0.01
IGL02679:Ptpn13 APN 5 103569454 missense possibly damaging 0.55
IGL02981:Ptpn13 APN 5 103528804 missense probably damaging 1.00
IGL03131:Ptpn13 APN 5 103517559 missense probably benign
IGL03136:Ptpn13 APN 5 103543463 missense possibly damaging 0.49
IGL03163:Ptpn13 APN 5 103591346 missense probably damaging 1.00
IGL03271:Ptpn13 APN 5 103462148 missense probably damaging 1.00
IGL03297:Ptpn13 APN 5 103541077 missense probably benign 0.13
IGL03328:Ptpn13 APN 5 103516348 missense probably benign 0.00
IGL03343:Ptpn13 APN 5 103554950 missense possibly damaging 0.88
IGL02835:Ptpn13 UTSW 5 103560025 missense probably damaging 0.98
P0021:Ptpn13 UTSW 5 103528820 missense probably benign 0.39
R0017:Ptpn13 UTSW 5 103486772 critical splice donor site probably null
R0090:Ptpn13 UTSW 5 103569503 missense probably damaging 1.00
R0111:Ptpn13 UTSW 5 103580763 splice site probably benign
R0183:Ptpn13 UTSW 5 103516408 missense probably benign 0.00
R0230:Ptpn13 UTSW 5 103527131 missense probably damaging 1.00
R0302:Ptpn13 UTSW 5 103565225 missense probably benign
R0360:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0364:Ptpn13 UTSW 5 103533348 missense probably damaging 1.00
R0388:Ptpn13 UTSW 5 103555062 missense probably benign 0.31
R0504:Ptpn13 UTSW 5 103501496 missense possibly damaging 0.92
R0558:Ptpn13 UTSW 5 103529717 missense probably damaging 0.99
R0562:Ptpn13 UTSW 5 103516425 critical splice donor site probably null
R0568:Ptpn13 UTSW 5 103489765 missense probably damaging 1.00
R0609:Ptpn13 UTSW 5 103556145 missense probably benign
R0669:Ptpn13 UTSW 5 103556109 missense probably benign
R0739:Ptpn13 UTSW 5 103575132 missense probably benign
R1006:Ptpn13 UTSW 5 103586789 missense probably benign 0.04
R1164:Ptpn13 UTSW 5 103489773 missense probably damaging 1.00
R1274:Ptpn13 UTSW 5 103550260 missense probably damaging 0.98
R1501:Ptpn13 UTSW 5 103516364 missense probably benign 0.01
R1529:Ptpn13 UTSW 5 103564132 missense probably benign 0.00
R1533:Ptpn13 UTSW 5 103556178 nonsense probably null
R1613:Ptpn13 UTSW 5 103536871 missense possibly damaging 0.89
R1616:Ptpn13 UTSW 5 103565237 missense possibly damaging 0.49
R1830:Ptpn13 UTSW 5 103543459 missense probably benign 0.00
R1892:Ptpn13 UTSW 5 103501679 missense possibly damaging 0.92
R1907:Ptpn13 UTSW 5 103580709 missense probably null 0.45
R2143:Ptpn13 UTSW 5 103556133 missense probably benign
R2145:Ptpn13 UTSW 5 103556133 missense probably benign
R2151:Ptpn13 UTSW 5 103525785 missense probably damaging 1.00
R2180:Ptpn13 UTSW 5 103569558 missense probably damaging 1.00
R2264:Ptpn13 UTSW 5 103489661 missense possibly damaging 0.96
R2313:Ptpn13 UTSW 5 103564161 missense probably damaging 1.00
R3522:Ptpn13 UTSW 5 103589854 splice site probably benign
R3773:Ptpn13 UTSW 5 103477121 missense probably damaging 1.00
R3924:Ptpn13 UTSW 5 103550741 splice site probably benign
R4289:Ptpn13 UTSW 5 103533285 missense probably damaging 1.00
R4348:Ptpn13 UTSW 5 103569726 missense probably damaging 1.00
R4526:Ptpn13 UTSW 5 103501469 missense probably benign 0.32
R4557:Ptpn13 UTSW 5 103541110 missense probably damaging 1.00
R4596:Ptpn13 UTSW 5 103523692 missense probably benign 0.06
R4632:Ptpn13 UTSW 5 103569860 missense possibly damaging 0.46
R4727:Ptpn13 UTSW 5 103569855 missense probably benign
R4780:Ptpn13 UTSW 5 103586773 missense probably benign 0.04
R4793:Ptpn13 UTSW 5 103582778 critical splice donor site probably null
R4812:Ptpn13 UTSW 5 103523615 missense probably benign 0.00
R4939:Ptpn13 UTSW 5 103517469 intron probably null
R4951:Ptpn13 UTSW 5 103588046 missense probably benign 0.00
R5052:Ptpn13 UTSW 5 103561980 missense probably damaging 1.00
R5148:Ptpn13 UTSW 5 103492232 missense probably damaging 1.00
R5309:Ptpn13 UTSW 5 103541053 missense probably damaging 1.00
R5521:Ptpn13 UTSW 5 103501428 missense probably benign 0.03
R5545:Ptpn13 UTSW 5 103561964 missense probably damaging 1.00
R5696:Ptpn13 UTSW 5 103554759 missense probably benign 0.20
R5735:Ptpn13 UTSW 5 103554820 missense probably benign 0.03
R5815:Ptpn13 UTSW 5 103597690 splice site probably null
R5876:Ptpn13 UTSW 5 103476960 missense probably damaging 1.00
R5878:Ptpn13 UTSW 5 103477118 missense possibly damaging 0.89
R6366:Ptpn13 UTSW 5 103551053 missense probably damaging 1.00
R6455:Ptpn13 UTSW 5 103541284 missense probably benign 0.00
R6492:Ptpn13 UTSW 5 103501612 missense probably benign 0.02
R6709:Ptpn13 UTSW 5 103586756 missense probably benign 0.18
R6759:Ptpn13 UTSW 5 103565255 missense possibly damaging 0.49
R6944:Ptpn13 UTSW 5 103476991 missense probably null 1.00
R7079:Ptpn13 UTSW 5 103501886 missense probably benign 0.00
R7253:Ptpn13 UTSW 5 103565284 missense possibly damaging 0.68
R7254:Ptpn13 UTSW 5 103594636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TTAACGCACGTGCATCACC -3'
(R):5'- AATGCATCCCTAGGTGTTCAG -3'

Sequencing Primer
(F):5'- GTGTTCCAACAGGTCTGCCAAAG -3'
(R):5'- GCATCCCTAGGTGTTCAGAAAATC -3'
Posted On2015-07-06