Incidental Mutation 'R4385:2810474O19Rik'
ID326163
Institutional Source Beutler Lab
Gene Symbol 2810474O19Rik
Ensembl Gene ENSMUSG00000032712
Gene NameRIKEN cDNA 2810474O19 gene
SynonymsGET
MMRRC Submission 041124-MU
Accession Numbers

Genbank: NM_026054; MGI: 1914496

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4385 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location149309414-149335663 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 149326208 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 251 (S251P)
Ref Sequence ENSEMBL: ENSMUSP00000140026 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046689] [ENSMUST00000100765] [ENSMUST00000127680] [ENSMUST00000130664] [ENSMUST00000185930] [ENSMUST00000187881] [ENSMUST00000189837] [ENSMUST00000189932] [ENSMUST00000190785]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046689
AA Change: S251P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000041180
Gene: ENSMUSG00000032712
AA Change: S251P

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000100765
AA Change: S251P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000098328
Gene: ENSMUSG00000032712
AA Change: S251P

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000127680
Predicted Effect possibly damaging
Transcript: ENSMUST00000130664
AA Change: S251P

PolyPhen 2 Score 0.509 (Sensitivity: 0.88; Specificity: 0.90)
Predicted Effect probably benign
Transcript: ENSMUST00000185930
Predicted Effect probably benign
Transcript: ENSMUST00000187881
Predicted Effect possibly damaging
Transcript: ENSMUST00000189837
AA Change: S251P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000139660
Gene: ENSMUSG00000032712
AA Change: S251P

DomainStartEndE-ValueType
Pfam:DUF4617 451 1511 N/A PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000189932
AA Change: S251P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140026
Gene: ENSMUSG00000032712
AA Change: S251P

DomainStartEndE-ValueType
Pfam:DUF4617 451 1513 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190785
AA Change: S251P

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139624
Gene: ENSMUSG00000032712
AA Change: S251P

DomainStartEndE-ValueType
Pfam:DUF4617 451 1173 9.4e-255 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI

All alleles(126) : Targeted, knock-out(1) Gene trapped(125)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A530032D15Rik C T 1: 85,109,336 probably null Het
Abcc3 A T 11: 94,368,239 I426N probably damaging Het
Abcc6 C T 7: 45,995,328 V808I possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Apbb1 A G 7: 105,567,276 S140P probably benign Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cdc27 T C 11: 104,534,814 R59G probably benign Het
Cfap43 T C 19: 47,797,129 R441G probably benign Het
Chsy3 A G 18: 59,176,352 I226V probably benign Het
Chsy3 A T 18: 59,179,474 T340S possibly damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Col5a1 A C 2: 28,024,779 M136L probably damaging Het
Coro2a A T 4: 46,541,961 I387N possibly damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Cyfip2 C T 11: 46,242,403 M823I probably benign Het
Dcbld2 A G 16: 58,463,066 K555E probably damaging Het
Dpep3 A G 8: 105,978,186 M164T probably damaging Het
Flg C A 3: 93,293,009 probably benign Het
Gm13089 C T 4: 143,698,014 probably null Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Ift172 T C 5: 31,286,967 D37G probably damaging Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk1 A T 7: 44,228,569 D83V probably benign Het
Klk9 T C 7: 43,794,275 V71A probably benign Het
Loxhd1 A G 18: 77,372,911 K806R probably damaging Het
Metap1 T C 3: 138,475,063 E119G possibly damaging Het
Nbea T C 3: 56,000,638 H1351R possibly damaging Het
Nim1k T C 13: 119,712,626 D244G probably damaging Het
Npas1 C T 7: 16,459,185 probably null Het
Pcdh15 A G 10: 74,550,490 D1136G probably damaging Het
Pde6b A G 5: 108,427,642 I657V probably benign Het
Pi4ka A G 16: 17,386,265 V55A probably benign Het
Plxnb2 T C 15: 89,160,623 N1173S probably damaging Het
Ptpn13 T C 5: 103,533,407 probably null Het
Ptprb A G 10: 116,346,867 S1483G probably benign Het
Rbm48 G A 5: 3,590,300 P360S probably damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rfpl4 A G 7: 5,110,670 S165P possibly damaging Het
Scn9a A T 2: 66,484,556 L1595Q probably damaging Het
Scp2 A T 4: 108,071,350 V381D probably damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Slc30a9 T C 5: 67,315,767 Y65H probably damaging Het
Sorcs1 A G 19: 50,190,161 I841T probably benign Het
Spag7 C T 11: 70,669,203 A27T probably damaging Het
St6galnac6 A G 2: 32,615,024 I181V possibly damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Ugt3a1 C T 15: 9,306,479 S238F probably benign Het
Usp9y G A Y: 1,304,756 L2363F probably damaging Het
Vmn1r34 T A 6: 66,637,139 H205L probably damaging Het
Vps50 C A 6: 3,516,694 Q59K probably benign Het
Zeb2 T A 2: 45,023,062 D39V probably damaging Het
Zfp146 G A 7: 30,162,422 T65I probably benign Het
Zfp36 T C 7: 28,377,691 D264G probably benign Het
Other mutations in 2810474O19Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00767:2810474O19Rik APN 6 149334750 utr 3 prime probably benign
IGL01401:2810474O19Rik APN 6 149326896 missense probably damaging 0.98
IGL01461:2810474O19Rik APN 6 149331515 unclassified probably benign
IGL01610:2810474O19Rik APN 6 149328951 missense probably benign 0.01
IGL02873:2810474O19Rik APN 6 149327040 missense probably damaging 1.00
IGL03202:2810474O19Rik APN 6 149326439 missense probably benign 0.08
grand_junction UTSW 6 149327878 missense probably damaging 0.98
grand_marais UTSW 6 149326460 nonsense probably null
3-1:2810474O19Rik UTSW 6 149327729 missense probably damaging 0.98
B6584:2810474O19Rik UTSW 6 149329346 missense probably damaging 0.96
PIT4280001:2810474O19Rik UTSW 6 149325525 missense probably benign 0.23
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0053:2810474O19Rik UTSW 6 149327590 missense probably benign 0.00
R0243:2810474O19Rik UTSW 6 149326241 missense probably damaging 1.00
R0620:2810474O19Rik UTSW 6 149328375 missense probably damaging 1.00
R0633:2810474O19Rik UTSW 6 149325701 missense probably benign 0.00
R0727:2810474O19Rik UTSW 6 149325822 missense possibly damaging 0.94
R0904:2810474O19Rik UTSW 6 149328269 missense probably damaging 0.99
R1221:2810474O19Rik UTSW 6 149326221 missense probably benign 0.24
R1282:2810474O19Rik UTSW 6 149329172 nonsense probably null
R1435:2810474O19Rik UTSW 6 149326082 missense probably benign 0.04
R1452:2810474O19Rik UTSW 6 149326632 missense probably damaging 1.00
R1587:2810474O19Rik UTSW 6 149326520 missense probably damaging 1.00
R1912:2810474O19Rik UTSW 6 149328844 missense possibly damaging 0.80
R1926:2810474O19Rik UTSW 6 149329404 missense probably benign 0.39
R1978:2810474O19Rik UTSW 6 149326432 missense probably damaging 0.97
R2035:2810474O19Rik UTSW 6 149329226 missense possibly damaging 0.91
R2136:2810474O19Rik UTSW 6 149328822 missense probably benign 0.01
R2333:2810474O19Rik UTSW 6 149327511 missense probably damaging 1.00
R2360:2810474O19Rik UTSW 6 149334647 missense probably benign 0.05
R3027:2810474O19Rik UTSW 6 149329035 missense probably benign 0.02
R3121:2810474O19Rik UTSW 6 149329243 nonsense probably null
R3707:2810474O19Rik UTSW 6 149329113 missense probably damaging 0.98
R4204:2810474O19Rik UTSW 6 149329544 nonsense probably null
R4247:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4249:2810474O19Rik UTSW 6 149325543 missense possibly damaging 0.87
R4304:2810474O19Rik UTSW 6 149326238 nonsense probably null
R4702:2810474O19Rik UTSW 6 149329403 missense probably benign 0.05
R4747:2810474O19Rik UTSW 6 149326894 missense probably damaging 0.96
R4912:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4913:2810474O19Rik UTSW 6 149329389 missense probably damaging 1.00
R4965:2810474O19Rik UTSW 6 149328398 nonsense probably null
R4971:2810474O19Rik UTSW 6 149325599 unclassified probably benign
R5077:2810474O19Rik UTSW 6 149326030 missense probably benign 0.14
R5213:2810474O19Rik UTSW 6 149326053 missense possibly damaging 0.77
R5382:2810474O19Rik UTSW 6 149326460 nonsense probably null
R5418:2810474O19Rik UTSW 6 149326136 missense probably damaging 1.00
R5452:2810474O19Rik UTSW 6 149329113 nonsense probably null
R5498:2810474O19Rik UTSW 6 149328240 missense probably damaging 0.99
R5673:2810474O19Rik UTSW 6 149327993 nonsense probably null
R5690:2810474O19Rik UTSW 6 149328237 missense possibly damaging 0.95
R5916:2810474O19Rik UTSW 6 149326578 missense probably damaging 0.99
R5917:2810474O19Rik UTSW 6 149334681 missense probably damaging 0.98
R6160:2810474O19Rik UTSW 6 149331507 critical splice donor site probably null
R6280:2810474O19Rik UTSW 6 149327057 missense probably damaging 1.00
R6326:2810474O19Rik UTSW 6 149328995 missense probably damaging 0.96
R6396:2810474O19Rik UTSW 6 149327919 missense probably damaging 1.00
R6702:2810474O19Rik UTSW 6 149327878 missense probably damaging 0.98
R6972:2810474O19Rik UTSW 6 149326109 missense probably damaging 0.99
R7127:2810474O19Rik UTSW 6 149327945 missense possibly damaging 0.95
R7168:2810474O19Rik UTSW 6 149327843 missense probably benign
R7316:2810474O19Rik UTSW 6 149326638 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AGGGACTTAATCACTTCATACCAGATC -3'
(R):5'- TTAGGGTTCTGCCACTGCTG -3'

Sequencing Primer
(F):5'- ATACCAGATCAGTTGGTTGACTGGAC -3'
(R):5'- ACTGCTGCTTAAAGCCTCTGTAAG -3'
Posted On2015-07-06