Incidental Mutation 'R4385:Apbb1'
ID326171
Institutional Source Beutler Lab
Gene Symbol Apbb1
Ensembl Gene ENSMUSG00000037032
Gene Nameamyloid beta (A4) precursor protein-binding, family B, member 1
SynonymsFe65, Rir
MMRRC Submission 041124-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4385 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location105558483-105581653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 105567276 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 140 (S140P)
Ref Sequence ENSEMBL: ENSMUSP00000140192 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000081165] [ENSMUST00000186814] [ENSMUST00000186868] [ENSMUST00000187051] [ENSMUST00000187057] [ENSMUST00000187683] [ENSMUST00000187721] [ENSMUST00000188001] [ENSMUST00000188368] [ENSMUST00000188440] [ENSMUST00000189072] [ENSMUST00000189265] [ENSMUST00000189378] [ENSMUST00000190369] [ENSMUST00000191011] [ENSMUST00000191601] [ENSMUST00000210079]
Predicted Effect probably benign
Transcript: ENSMUST00000081165
AA Change: S340P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079932
Gene: ENSMUSG00000037032
AA Change: S340P

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 4.16e-38 SMART
PTB 538 667 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000186814
AA Change: S7P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000186868
AA Change: S81P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140052
Gene: ENSMUSG00000037032
AA Change: S81P

DomainStartEndE-ValueType
Pfam:WW 1 24 1.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187051
AA Change: S81P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139755
Gene: ENSMUSG00000037032
AA Change: S81P

DomainStartEndE-ValueType
Pfam:WW 1 24 1.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
SCOP:d1shca_ 74 120 9e-7 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187057
AA Change: S117P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139899
Gene: ENSMUSG00000037032
AA Change: S117P

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 287 3.8e-41 SMART
PTB 313 442 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000187683
AA Change: S81P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139426
Gene: ENSMUSG00000037032
AA Change: S81P

DomainStartEndE-ValueType
Pfam:WW 1 24 2.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
Pfam:PID 111 158 5.9e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000187721
AA Change: S140P

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140192
Gene: ENSMUSG00000037032
AA Change: S140P

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
WW 54 85 3.7e-7 SMART
low complexity region 87 99 N/A INTRINSIC
Pfam:PID 170 242 1.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000188001
Predicted Effect probably benign
Transcript: ENSMUST00000188368
AA Change: S117P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139788
Gene: ENSMUSG00000037032
AA Change: S117P

DomainStartEndE-ValueType
WW 31 62 3.7e-7 SMART
low complexity region 64 76 N/A INTRINSIC
PTB 142 289 1.8e-40 SMART
PTB 315 444 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000188440
AA Change: S81P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140715
Gene: ENSMUSG00000037032
AA Change: S81P

DomainStartEndE-ValueType
Pfam:WW 1 24 3.4e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 223 1.4e-14 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189072
AA Change: S81P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000139575
Gene: ENSMUSG00000037032
AA Change: S81P

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189265
SMART Domains Protein: ENSMUSP00000140137
Gene: ENSMUSG00000037032

DomainStartEndE-ValueType
Pfam:PID 1 34 2.3e-6 PFAM
PTB 63 192 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000189378
AA Change: S340P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140979
Gene: ENSMUSG00000037032
AA Change: S340P

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000190369
AA Change: S81P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140486
Gene: ENSMUSG00000037032
AA Change: S81P

DomainStartEndE-ValueType
Pfam:WW 1 24 8.1e-5 PFAM
low complexity region 28 40 N/A INTRINSIC
PTB 106 253 1.8e-40 SMART
PTB 279 408 9.5e-39 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190961
Predicted Effect probably benign
Transcript: ENSMUST00000191011
AA Change: S340P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140973
Gene: ENSMUSG00000037032
AA Change: S340P

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 6.23e-5 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 510 6.86e-39 SMART
PTB 536 665 1.76e-36 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191250
Predicted Effect probably benign
Transcript: ENSMUST00000191601
AA Change: S340P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000140116
Gene: ENSMUSG00000037032
AA Change: S340P

DomainStartEndE-ValueType
low complexity region 146 184 N/A INTRINSIC
WW 254 285 3.7e-7 SMART
low complexity region 287 299 N/A INTRINSIC
PTB 365 512 1.8e-40 SMART
PTB 538 667 9.5e-39 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000210079
AA Change: S81P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000211614
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the Fe65 protein family. It is an adaptor protein localized in the nucleus. It interacts with the Alzheimer's disease amyloid precursor protein (APP), transcription factor CP2/LSF/LBP1 and the low-density lipoprotein receptor-related protein. APP functions as a cytosolic anchoring site that can prevent the gene product's nuclear translocation. This encoded protein could play an important role in the pathogenesis of Alzheimer's disease. It is thought to regulate transcription. Also it is observed to block cell cycle progression by downregulating thymidylate synthase expression. Multiple alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Mar 2012]
PHENOTYPE: Homozygotes for a null allele are hypersensitive to ionizing radiation while mouse embryonic fibroblasts are hypersensitive to DNA damaging agents. Homozygotes for a second null allele display impaired performance in learning and memory tasks, with a striking deficit in reversal spatial learning. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,208 S251P possibly damaging Het
A530032D15Rik C T 1: 85,109,336 probably null Het
Abcc3 A T 11: 94,368,239 I426N probably damaging Het
Abcc6 C T 7: 45,995,328 V808I possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cdc27 T C 11: 104,534,814 R59G probably benign Het
Cfap43 T C 19: 47,797,129 R441G probably benign Het
Chsy3 A G 18: 59,176,352 I226V probably benign Het
Chsy3 A T 18: 59,179,474 T340S possibly damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Col5a1 A C 2: 28,024,779 M136L probably damaging Het
Coro2a A T 4: 46,541,961 I387N possibly damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Cyfip2 C T 11: 46,242,403 M823I probably benign Het
Dcbld2 A G 16: 58,463,066 K555E probably damaging Het
Dpep3 A G 8: 105,978,186 M164T probably damaging Het
Flg C A 3: 93,293,009 probably benign Het
Gm13089 C T 4: 143,698,014 probably null Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Ift172 T C 5: 31,286,967 D37G probably damaging Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk1 A T 7: 44,228,569 D83V probably benign Het
Klk9 T C 7: 43,794,275 V71A probably benign Het
Loxhd1 A G 18: 77,372,911 K806R probably damaging Het
Metap1 T C 3: 138,475,063 E119G possibly damaging Het
Nbea T C 3: 56,000,638 H1351R possibly damaging Het
Nim1k T C 13: 119,712,626 D244G probably damaging Het
Npas1 C T 7: 16,459,185 probably null Het
Pcdh15 A G 10: 74,550,490 D1136G probably damaging Het
Pde6b A G 5: 108,427,642 I657V probably benign Het
Pi4ka A G 16: 17,386,265 V55A probably benign Het
Plxnb2 T C 15: 89,160,623 N1173S probably damaging Het
Ptpn13 T C 5: 103,533,407 probably null Het
Ptprb A G 10: 116,346,867 S1483G probably benign Het
Rbm48 G A 5: 3,590,300 P360S probably damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rfpl4 A G 7: 5,110,670 S165P possibly damaging Het
Scn9a A T 2: 66,484,556 L1595Q probably damaging Het
Scp2 A T 4: 108,071,350 V381D probably damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Slc30a9 T C 5: 67,315,767 Y65H probably damaging Het
Sorcs1 A G 19: 50,190,161 I841T probably benign Het
Spag7 C T 11: 70,669,203 A27T probably damaging Het
St6galnac6 A G 2: 32,615,024 I181V possibly damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Ugt3a1 C T 15: 9,306,479 S238F probably benign Het
Usp9y G A Y: 1,304,756 L2363F probably damaging Het
Vmn1r34 T A 6: 66,637,139 H205L probably damaging Het
Vps50 C A 6: 3,516,694 Q59K probably benign Het
Zeb2 T A 2: 45,023,062 D39V probably damaging Het
Zfp146 G A 7: 30,162,422 T65I probably benign Het
Zfp36 T C 7: 28,377,691 D264G probably benign Het
Other mutations in Apbb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02171:Apbb1 APN 7 105559126 splice site probably benign
athena UTSW 7 105566695 missense probably benign
R0092:Apbb1 UTSW 7 105559154 missense probably damaging 1.00
R0348:Apbb1 UTSW 7 105565303 missense probably damaging 0.98
R0633:Apbb1 UTSW 7 105558963 missense probably damaging 1.00
R0946:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1076:Apbb1 UTSW 7 105573855 missense probably benign 0.09
R1332:Apbb1 UTSW 7 105565543 missense possibly damaging 0.74
R1658:Apbb1 UTSW 7 105574084 missense probably damaging 1.00
R1739:Apbb1 UTSW 7 105574227 missense probably benign
R4230:Apbb1 UTSW 7 105567684 missense probably damaging 1.00
R4296:Apbb1 UTSW 7 105573826 missense probably benign 0.16
R4571:Apbb1 UTSW 7 105573762 missense probably damaging 1.00
R4647:Apbb1 UTSW 7 105565538 missense probably benign 0.01
R4812:Apbb1 UTSW 7 105574025 missense probably damaging 0.99
R5044:Apbb1 UTSW 7 105565682 intron probably benign
R5109:Apbb1 UTSW 7 105565035 missense probably damaging 1.00
R5479:Apbb1 UTSW 7 105565025 missense probably damaging 0.97
R5611:Apbb1 UTSW 7 105559483 missense probably damaging 1.00
R5677:Apbb1 UTSW 7 105559246 missense probably damaging 1.00
R5785:Apbb1 UTSW 7 105567715 missense probably damaging 1.00
R5850:Apbb1 UTSW 7 105567583 missense probably damaging 1.00
R5896:Apbb1 UTSW 7 105574225 missense probably damaging 1.00
R6151:Apbb1 UTSW 7 105574252 nonsense probably null
R6186:Apbb1 UTSW 7 105567726 missense probably damaging 1.00
R6229:Apbb1 UTSW 7 105573730 missense probably damaging 0.98
R6229:Apbb1 UTSW 7 105573731 missense probably damaging 0.98
R6288:Apbb1 UTSW 7 105559227 missense probably damaging 1.00
R6295:Apbb1 UTSW 7 105566695 missense probably benign
R6443:Apbb1 UTSW 7 105573763 missense probably damaging 1.00
R6729:Apbb1 UTSW 7 105565381 missense probably damaging 1.00
R7130:Apbb1 UTSW 7 105565331 missense probably damaging 0.98
R7209:Apbb1 UTSW 7 105566085 missense probably damaging 1.00
Z1088:Apbb1 UTSW 7 105559136 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAACAAACCTTGATCCCTGGG -3'
(R):5'- TGGCTTTGCTCACCAAGAAG -3'

Sequencing Primer
(F):5'- AACCTTGATCCCTGGGTTGGC -3'
(R):5'- TGCTCACCAAGAAGGCTTTG -3'
Posted On2015-07-06