Incidental Mutation 'R4385:Cyfip2'
Institutional Source Beutler Lab
Gene Symbol Cyfip2
Ensembl Gene ENSMUSG00000020340
Gene Namecytoplasmic FMR1 interacting protein 2
Synonyms1500004I01Rik, Pir121, 6430511D02Rik
MMRRC Submission 041124-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R4385 (G1)
Quality Score225
Status Not validated
Chromosomal Location46193850-46312859 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 46242403 bp
Amino Acid Change Methionine to Isoleucine at position 823 (M823I)
Ref Sequence ENSEMBL: ENSMUSP00000127586 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000060185] [ENSMUST00000093165] [ENSMUST00000093166] [ENSMUST00000165599]
Predicted Effect probably benign
Transcript: ENSMUST00000060185
SMART Domains Protein: ENSMUSP00000060509
Gene: ENSMUSG00000048721

Blast:FN3 1 85 5e-53 BLAST
SCOP:d1fnf_2 2 82 5e-8 SMART
transmembrane domain 116 138 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093165
AA Change: M823I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000090853
Gene: ENSMUSG00000020340
AA Change: M823I

low complexity region 15 27 N/A INTRINSIC
Pfam:DUF1394 59 303 5.4e-12 PFAM
Pfam:FragX_IP 388 1221 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093166
AA Change: M823I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000090854
Gene: ENSMUSG00000020340
AA Change: M823I

low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117362
Predicted Effect unknown
Transcript: ENSMUST00000142017
AA Change: M517I
SMART Domains Protein: ENSMUSP00000119801
Gene: ENSMUSG00000020340
AA Change: M517I

Pfam:FragX_IP 58 230 4e-66 PFAM
Pfam:FragX_IP 246 916 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165599
AA Change: M823I

PolyPhen 2 Score 0.046 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000127586
Gene: ENSMUSG00000020340
AA Change: M823I

low complexity region 15 27 N/A INTRINSIC
Pfam:FragX_IP 384 1223 N/A PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for knock-out allele exhibit complete neonatal lethality. Mice homozygous for a dominant spontaneous mutation exhibit impaired behavioral response to cocaine, fewer dendritic spines and reduced miniature excitatory postsynaptic current frequency. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,208 S251P possibly damaging Het
A530032D15Rik C T 1: 85,109,336 probably null Het
Abcc3 A T 11: 94,368,239 I426N probably damaging Het
Abcc6 C T 7: 45,995,328 V808I possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Apbb1 A G 7: 105,567,276 S140P probably benign Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cdc27 T C 11: 104,534,814 R59G probably benign Het
Cfap43 T C 19: 47,797,129 R441G probably benign Het
Chsy3 A G 18: 59,176,352 I226V probably benign Het
Chsy3 A T 18: 59,179,474 T340S possibly damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Col5a1 A C 2: 28,024,779 M136L probably damaging Het
Coro2a A T 4: 46,541,961 I387N possibly damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Dcbld2 A G 16: 58,463,066 K555E probably damaging Het
Dpep3 A G 8: 105,978,186 M164T probably damaging Het
Flg C A 3: 93,293,009 probably benign Het
Gm13089 C T 4: 143,698,014 probably null Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Ift172 T C 5: 31,286,967 D37G probably damaging Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk1 A T 7: 44,228,569 D83V probably benign Het
Klk9 T C 7: 43,794,275 V71A probably benign Het
Loxhd1 A G 18: 77,372,911 K806R probably damaging Het
Metap1 T C 3: 138,475,063 E119G possibly damaging Het
Nbea T C 3: 56,000,638 H1351R possibly damaging Het
Nim1k T C 13: 119,712,626 D244G probably damaging Het
Npas1 C T 7: 16,459,185 probably null Het
Pcdh15 A G 10: 74,550,490 D1136G probably damaging Het
Pde6b A G 5: 108,427,642 I657V probably benign Het
Pi4ka A G 16: 17,386,265 V55A probably benign Het
Plxnb2 T C 15: 89,160,623 N1173S probably damaging Het
Ptpn13 T C 5: 103,533,407 probably null Het
Ptprb A G 10: 116,346,867 S1483G probably benign Het
Rbm48 G A 5: 3,590,300 P360S probably damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rfpl4 A G 7: 5,110,670 S165P possibly damaging Het
Scn9a A T 2: 66,484,556 L1595Q probably damaging Het
Scp2 A T 4: 108,071,350 V381D probably damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Slc30a9 T C 5: 67,315,767 Y65H probably damaging Het
Sorcs1 A G 19: 50,190,161 I841T probably benign Het
Spag7 C T 11: 70,669,203 A27T probably damaging Het
St6galnac6 A G 2: 32,615,024 I181V possibly damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Ugt3a1 C T 15: 9,306,479 S238F probably benign Het
Usp9y G A Y: 1,304,756 L2363F probably damaging Het
Vmn1r34 T A 6: 66,637,139 H205L probably damaging Het
Vps50 C A 6: 3,516,694 Q59K probably benign Het
Zeb2 T A 2: 45,023,062 D39V probably damaging Het
Zfp146 G A 7: 30,162,422 T65I probably benign Het
Zfp36 T C 7: 28,377,691 D264G probably benign Het
Other mutations in Cyfip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00906:Cyfip2 APN 11 46200685 missense possibly damaging 0.74
IGL01352:Cyfip2 APN 11 46265996 missense probably benign 0.01
IGL01685:Cyfip2 APN 11 46207488 splice site probably benign
IGL02367:Cyfip2 APN 11 46276905 nonsense probably null
IGL02390:Cyfip2 APN 11 46221398 missense possibly damaging 0.58
IGL02471:Cyfip2 APN 11 46200803 missense possibly damaging 0.58
IGL02583:Cyfip2 APN 11 46249758 missense possibly damaging 0.56
IGL03199:Cyfip2 APN 11 46276843 missense probably benign 0.07
IGL02835:Cyfip2 UTSW 11 46249771 missense probably benign 0.00
R0081:Cyfip2 UTSW 11 46253998 nonsense probably null
R0288:Cyfip2 UTSW 11 46253972 missense possibly damaging 0.94
R1830:Cyfip2 UTSW 11 46199019 missense probably damaging 1.00
R1869:Cyfip2 UTSW 11 46224168 missense probably benign 0.40
R1989:Cyfip2 UTSW 11 46253998 nonsense probably null
R2045:Cyfip2 UTSW 11 46249789 missense probably benign 0.00
R2101:Cyfip2 UTSW 11 46242443 missense probably damaging 1.00
R2131:Cyfip2 UTSW 11 46286131 missense possibly damaging 0.78
R2162:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R2299:Cyfip2 UTSW 11 46286131 missense probably benign 0.02
R3831:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3832:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3833:Cyfip2 UTSW 11 46261506 missense probably benign 0.03
R3881:Cyfip2 UTSW 11 46208335 missense probably damaging 1.00
R4127:Cyfip2 UTSW 11 46270647 missense probably benign 0.00
R4617:Cyfip2 UTSW 11 46254018 missense probably damaging 1.00
R4739:Cyfip2 UTSW 11 46279993 missense probably damaging 0.99
R5232:Cyfip2 UTSW 11 46242378 missense probably damaging 1.00
R5365:Cyfip2 UTSW 11 46247630 missense probably damaging 0.99
R5383:Cyfip2 UTSW 11 46278091 missense possibly damaging 0.83
R5447:Cyfip2 UTSW 11 46291586 missense possibly damaging 0.72
R5450:Cyfip2 UTSW 11 46284252 missense probably benign 0.00
R5796:Cyfip2 UTSW 11 46198996 missense probably benign 0.01
R5820:Cyfip2 UTSW 11 46200704 missense probably damaging 1.00
R5925:Cyfip2 UTSW 11 46207436 missense probably damaging 1.00
R6143:Cyfip2 UTSW 11 46253965 nonsense probably null
R6321:Cyfip2 UTSW 11 46291520 missense probably benign 0.01
R6502:Cyfip2 UTSW 11 46221346 missense probably damaging 1.00
R6511:Cyfip2 UTSW 11 46196308 missense probably benign 0.00
R6521:Cyfip2 UTSW 11 46254588 missense probably damaging 1.00
R6660:Cyfip2 UTSW 11 46249807 missense possibly damaging 0.89
R6836:Cyfip2 UTSW 11 46272640 missense probably benign 0.16
R6866:Cyfip2 UTSW 11 46242459 nonsense probably null
R7062:Cyfip2 UTSW 11 46260832 missense probably damaging 1.00
R7192:Cyfip2 UTSW 11 46254666 missense probably benign 0.21
R7231:Cyfip2 UTSW 11 46224136 missense probably benign
R7258:Cyfip2 UTSW 11 46224177 missense probably benign 0.02
R7365:Cyfip2 UTSW 11 46207440 nonsense probably null
R7441:Cyfip2 UTSW 11 46196427 missense possibly damaging 0.80
Predicted Primers PCR Primer

Sequencing Primer
Posted On2015-07-06