Incidental Mutation 'R4385:Spag7'
ID326179
Institutional Source Beutler Lab
Gene Symbol Spag7
Ensembl Gene ENSMUSG00000018287
Gene Namesperm associated antigen 7
SynonymsFsa1l, FSA-1
MMRRC Submission 041124-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4385 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location70663771-70669416 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 70669203 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Threonine at position 27 (A27T)
Ref Sequence ENSEMBL: ENSMUSP00000115098 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018431] [ENSMUST00000036299] [ENSMUST00000100933] [ENSMUST00000108544] [ENSMUST00000108545] [ENSMUST00000119120] [ENSMUST00000120261] [ENSMUST00000129434] [ENSMUST00000145823]
Predicted Effect probably damaging
Transcript: ENSMUST00000018431
AA Change: A27T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018431
Gene: ENSMUSG00000018287
AA Change: A27T

DomainStartEndE-ValueType
R3H 31 109 3.85e-21 SMART
low complexity region 130 152 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000036299
SMART Domains Protein: ENSMUSP00000043792
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 155 1.07e-83 SMART
low complexity region 232 243 N/A INTRINSIC
low complexity region 273 291 N/A INTRINSIC
low complexity region 294 305 N/A INTRINSIC
low complexity region 314 329 N/A INTRINSIC
low complexity region 370 380 N/A INTRINSIC
low complexity region 417 435 N/A INTRINSIC
low complexity region 461 485 N/A INTRINSIC
low complexity region 501 514 N/A INTRINSIC
Pfam:TIG 541 621 6.2e-13 PFAM
low complexity region 660 679 N/A INTRINSIC
Blast:ANK 717 750 7e-12 BLAST
SCOP:d1myo__ 718 816 2e-15 SMART
Blast:ANK 762 792 4e-11 BLAST
low complexity region 829 839 N/A INTRINSIC
low complexity region 844 853 N/A INTRINSIC
low complexity region 861 882 N/A INTRINSIC
IQ 1053 1075 2.59e2 SMART
IQ 1076 1092 2.38e2 SMART
IQ 1106 1128 5.42e0 SMART
low complexity region 1140 1157 N/A INTRINSIC
low complexity region 1180 1190 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000100933
SMART Domains Protein: ENSMUSP00000098493
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 36 152 8.08e-88 SMART
low complexity region 229 240 N/A INTRINSIC
low complexity region 270 288 N/A INTRINSIC
low complexity region 291 302 N/A INTRINSIC
low complexity region 311 326 N/A INTRINSIC
low complexity region 367 377 N/A INTRINSIC
low complexity region 414 432 N/A INTRINSIC
low complexity region 458 482 N/A INTRINSIC
low complexity region 498 511 N/A INTRINSIC
Pfam:TIG 538 618 1.2e-8 PFAM
low complexity region 657 676 N/A INTRINSIC
Blast:ANK 714 747 8e-12 BLAST
SCOP:d1myo__ 715 813 2e-15 SMART
Blast:ANK 759 789 4e-11 BLAST
low complexity region 826 836 N/A INTRINSIC
low complexity region 841 850 N/A INTRINSIC
low complexity region 858 879 N/A INTRINSIC
IQ 1050 1072 2.59e2 SMART
IQ 1073 1095 1.18e1 SMART
IQ 1096 1118 5.42e0 SMART
low complexity region 1130 1147 N/A INTRINSIC
low complexity region 1170 1180 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108544
SMART Domains Protein: ENSMUSP00000104184
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.2e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 4e-11 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1087 2.38e2 SMART
IQ 1101 1123 5.42e0 SMART
low complexity region 1135 1152 N/A INTRINSIC
low complexity region 1175 1185 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000108545
SMART Domains Protein: ENSMUSP00000104185
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1.1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 5e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1069 1.18e1 SMART
IQ 1070 1092 5.42e0 SMART
low complexity region 1104 1121 N/A INTRINSIC
low complexity region 1144 1154 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000119120
SMART Domains Protein: ENSMUSP00000113847
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 150 8.08e-88 SMART
low complexity region 227 238 N/A INTRINSIC
low complexity region 268 286 N/A INTRINSIC
low complexity region 289 300 N/A INTRINSIC
low complexity region 309 324 N/A INTRINSIC
low complexity region 365 375 N/A INTRINSIC
low complexity region 412 430 N/A INTRINSIC
low complexity region 456 480 N/A INTRINSIC
low complexity region 496 509 N/A INTRINSIC
Pfam:TIG 536 616 1.1e-8 PFAM
low complexity region 655 674 N/A INTRINSIC
Blast:ANK 712 745 7e-12 BLAST
SCOP:d1myo__ 713 811 2e-15 SMART
Blast:ANK 757 787 8e-13 BLAST
low complexity region 824 834 N/A INTRINSIC
low complexity region 839 848 N/A INTRINSIC
low complexity region 856 877 N/A INTRINSIC
IQ 1048 1070 2.59e2 SMART
IQ 1071 1093 1.18e1 SMART
IQ 1094 1116 5.42e0 SMART
low complexity region 1128 1145 N/A INTRINSIC
low complexity region 1168 1178 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000120261
SMART Domains Protein: ENSMUSP00000113667
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 126 3.23e-55 SMART
low complexity region 203 214 N/A INTRINSIC
low complexity region 244 262 N/A INTRINSIC
low complexity region 265 276 N/A INTRINSIC
low complexity region 285 300 N/A INTRINSIC
low complexity region 341 351 N/A INTRINSIC
low complexity region 388 406 N/A INTRINSIC
low complexity region 432 456 N/A INTRINSIC
low complexity region 472 485 N/A INTRINSIC
Pfam:TIG 512 592 1e-8 PFAM
low complexity region 631 650 N/A INTRINSIC
Blast:ANK 688 721 7e-12 BLAST
SCOP:d1myo__ 689 787 2e-15 SMART
Blast:ANK 733 763 7e-13 BLAST
low complexity region 800 810 N/A INTRINSIC
low complexity region 815 824 N/A INTRINSIC
low complexity region 832 853 N/A INTRINSIC
IQ 1024 1046 2.59e2 SMART
IQ 1047 1063 2.38e2 SMART
IQ 1077 1099 5.42e0 SMART
low complexity region 1111 1128 N/A INTRINSIC
low complexity region 1151 1161 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124691
Predicted Effect noncoding transcript
Transcript: ENSMUST00000125687
Predicted Effect probably damaging
Transcript: ENSMUST00000129434
AA Change: A27T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000115098
Gene: ENSMUSG00000018287
AA Change: A27T

DomainStartEndE-ValueType
R3H 22 99 3.06e-15 SMART
low complexity region 120 142 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137691
Predicted Effect probably benign
Transcript: ENSMUST00000145823
SMART Domains Protein: ENSMUSP00000123602
Gene: ENSMUSG00000040712

DomainStartEndE-ValueType
CG-1 34 137 2.55e-44 SMART
low complexity region 146 165 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2810474O19Rik T C 6: 149,326,208 S251P possibly damaging Het
A530032D15Rik C T 1: 85,109,336 probably null Het
Abcc3 A T 11: 94,368,239 I426N probably damaging Het
Abcc6 C T 7: 45,995,328 V808I possibly damaging Het
Adam23 T C 1: 63,566,628 Y624H probably damaging Het
Apbb1 A G 7: 105,567,276 S140P probably benign Het
Arhgef10 T A 8: 14,930,157 C132* probably null Het
Boc A T 16: 44,491,182 L726H probably damaging Het
Calr3 T A 8: 72,428,164 D120V probably damaging Het
Cdc27 T C 11: 104,534,814 R59G probably benign Het
Cfap43 T C 19: 47,797,129 R441G probably benign Het
Chsy3 A G 18: 59,176,352 I226V probably benign Het
Chsy3 A T 18: 59,179,474 T340S possibly damaging Het
Cnot10 T A 9: 114,631,881 K74* probably null Het
Col5a1 A C 2: 28,024,779 M136L probably damaging Het
Coro2a A T 4: 46,541,961 I387N possibly damaging Het
Csnk1g1 T C 9: 66,019,908 V119A probably damaging Het
Cyfip2 C T 11: 46,242,403 M823I probably benign Het
Dcbld2 A G 16: 58,463,066 K555E probably damaging Het
Dpep3 A G 8: 105,978,186 M164T probably damaging Het
Flg C A 3: 93,293,009 probably benign Het
Gm13089 C T 4: 143,698,014 probably null Het
Hecw1 C T 13: 14,316,164 D748N probably damaging Het
Ift172 T C 5: 31,286,967 D37G probably damaging Het
Iglc1 A T 16: 19,061,758 C104* probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Klk1 A T 7: 44,228,569 D83V probably benign Het
Klk9 T C 7: 43,794,275 V71A probably benign Het
Loxhd1 A G 18: 77,372,911 K806R probably damaging Het
Metap1 T C 3: 138,475,063 E119G possibly damaging Het
Nbea T C 3: 56,000,638 H1351R possibly damaging Het
Nim1k T C 13: 119,712,626 D244G probably damaging Het
Npas1 C T 7: 16,459,185 probably null Het
Pcdh15 A G 10: 74,550,490 D1136G probably damaging Het
Pde6b A G 5: 108,427,642 I657V probably benign Het
Pi4ka A G 16: 17,386,265 V55A probably benign Het
Plxnb2 T C 15: 89,160,623 N1173S probably damaging Het
Ptpn13 T C 5: 103,533,407 probably null Het
Ptprb A G 10: 116,346,867 S1483G probably benign Het
Rbm48 G A 5: 3,590,300 P360S probably damaging Het
Rbp3 G C 14: 33,955,296 E400D probably benign Het
Rfpl4 A G 7: 5,110,670 S165P possibly damaging Het
Scn9a A T 2: 66,484,556 L1595Q probably damaging Het
Scp2 A T 4: 108,071,350 V381D probably damaging Het
Sec24c G A 14: 20,690,773 V620M probably damaging Het
Slc30a9 T C 5: 67,315,767 Y65H probably damaging Het
Sorcs1 A G 19: 50,190,161 I841T probably benign Het
St6galnac6 A G 2: 32,615,024 I181V possibly damaging Het
Tm9sf3 T C 19: 41,247,933 M130V probably damaging Het
Ugt3a1 C T 15: 9,306,479 S238F probably benign Het
Usp9y G A Y: 1,304,756 L2363F probably damaging Het
Vmn1r34 T A 6: 66,637,139 H205L probably damaging Het
Vps50 C A 6: 3,516,694 Q59K probably benign Het
Zeb2 T A 2: 45,023,062 D39V probably damaging Het
Zfp146 G A 7: 30,162,422 T65I probably benign Het
Zfp36 T C 7: 28,377,691 D264G probably benign Het
Other mutations in Spag7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01764:Spag7 APN 11 70664107 unclassified probably benign
life_savers UTSW 11 70664862 missense probably damaging 1.00
R0371:Spag7 UTSW 11 70664796 missense probably damaging 1.00
R0376:Spag7 UTSW 11 70669190 unclassified probably benign
R0973:Spag7 UTSW 11 70669182 unclassified probably benign
R1622:Spag7 UTSW 11 70664862 missense probably damaging 1.00
R1955:Spag7 UTSW 11 70665018 missense probably benign 0.00
R4025:Spag7 UTSW 11 70664474 missense probably damaging 1.00
R4409:Spag7 UTSW 11 70664862 missense probably damaging 1.00
R4410:Spag7 UTSW 11 70664862 missense probably damaging 1.00
R4561:Spag7 UTSW 11 70664990 missense probably damaging 1.00
R5493:Spag7 UTSW 11 70669233 missense probably null 1.00
R6366:Spag7 UTSW 11 70664592 missense possibly damaging 0.71
R7283:Spag7 UTSW 11 70665313 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTGCAAAAGACAGCGGGC -3'
(R):5'- TAAACGTCTCTGCACCAGCTAG -3'

Sequencing Primer
(F):5'- ACTCTGAGGGTCTCAGAA -3'
(R):5'- AAGTCGCCGGCCTCATCTC -3'
Posted On2015-07-06