Incidental Mutation 'R4385:Sorcs1'
ID 326199
Institutional Source Beutler Lab
Gene Symbol Sorcs1
Ensembl Gene ENSMUSG00000043531
Gene Name sortilin-related VPS10 domain containing receptor 1
Synonyms
MMRRC Submission 041124-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.094) question?
Stock # R4385 (G1)
Quality Score 225
Status Not validated
Chromosome 19
Chromosomal Location 50131737-50667084 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 50178599 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Threonine at position 841 (I841T)
Ref Sequence ENSEMBL: ENSMUSP00000147456 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072685] [ENSMUST00000111756] [ENSMUST00000164039] [ENSMUST00000209413] [ENSMUST00000209783] [ENSMUST00000211008] [ENSMUST00000211687]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000072685
AA Change: I841T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000072472
Gene: ENSMUSG00000043531
AA Change: I841T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000111756
AA Change: I841T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000107386
Gene: ENSMUSG00000043531
AA Change: I841T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000164039
AA Change: I841T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000132615
Gene: ENSMUSG00000043531
AA Change: I841T

DomainStartEndE-ValueType
signal peptide 1 33 N/A INTRINSIC
low complexity region 94 113 N/A INTRINSIC
VPS10 196 797 N/A SMART
PKD 799 889 3.84e-1 SMART
PKD 897 975 8.63e-1 SMART
transmembrane domain 1098 1120 N/A INTRINSIC
low complexity region 1129 1142 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000168357
SMART Domains Protein: ENSMUSP00000129190
Gene: ENSMUSG00000043531

DomainStartEndE-ValueType
VPS10 1 320 6.99e-58 SMART
PKD 322 412 3.84e-1 SMART
PKD 420 498 8.63e-1 SMART
transmembrane domain 621 643 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000209413
AA Change: I841T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Predicted Effect probably benign
Transcript: ENSMUST00000209783
AA Change: I841T

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000211008
AA Change: I841T

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Predicted Effect probably benign
Transcript: ENSMUST00000211687
AA Change: I841T

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one family member of vacuolar protein sorting 10 (VPS10) domain-containing receptor proteins. The VPS10 domain name comes from the yeast carboxypeptidase Y sorting receptor Vps10 protein. Members of this gene family are large with many exons but the CDS lengths are usually less than 3700 nt. Very large introns typically separate the exons encoding the VPS10 domain; the remaining exons are separated by much smaller-sized introns. These genes are strongly expressed in the central nervous system. Two of the five family members (sortilin and sortilin-related receptor) are synthesized as preproproteins; it is not yet known if this encoded protein is also a preproprotein. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008]
PHENOTYPE: Female mice homozygous for a null allele have abnormal amyloid beta levels in the brain. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcc3 A T 11: 94,259,065 (GRCm39) I426N probably damaging Het
Abcc6 C T 7: 45,644,752 (GRCm39) V808I possibly damaging Het
Adam23 T C 1: 63,605,787 (GRCm39) Y624H probably damaging Het
Apbb1 A G 7: 105,216,483 (GRCm39) S140P probably benign Het
Arhgef10 T A 8: 14,980,157 (GRCm39) C132* probably null Het
Boc A T 16: 44,311,545 (GRCm39) L726H probably damaging Het
Calr3 T A 8: 73,182,008 (GRCm39) D120V probably damaging Het
Cdc27 T C 11: 104,425,640 (GRCm39) R59G probably benign Het
Cfap43 T C 19: 47,785,568 (GRCm39) R441G probably benign Het
Chsy3 A G 18: 59,309,424 (GRCm39) I226V probably benign Het
Chsy3 A T 18: 59,312,546 (GRCm39) T340S possibly damaging Het
Cnot10 T A 9: 114,460,949 (GRCm39) K74* probably null Het
Col5a1 A C 2: 27,914,791 (GRCm39) M136L probably damaging Het
Coro2a A T 4: 46,541,961 (GRCm39) I387N possibly damaging Het
Csnk1g1 T C 9: 65,927,190 (GRCm39) V119A probably damaging Het
Cyfip2 C T 11: 46,133,230 (GRCm39) M823I probably benign Het
Dcbld2 A G 16: 58,283,429 (GRCm39) K555E probably damaging Het
Dpep3 A G 8: 106,704,818 (GRCm39) M164T probably damaging Het
Flg C A 3: 93,200,316 (GRCm39) probably benign Het
Hecw1 C T 13: 14,490,749 (GRCm39) D748N probably damaging Het
Ift172 T C 5: 31,444,311 (GRCm39) D37G probably damaging Het
Iglc1 A T 16: 18,880,508 (GRCm39) C104* probably null Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 53,032,934 (GRCm39) 74 probably benign Het
Klk1 A T 7: 43,877,993 (GRCm39) D83V probably benign Het
Klk1b9 T C 7: 43,443,699 (GRCm39) V71A probably benign Het
Loxhd1 A G 18: 77,460,607 (GRCm39) K806R probably damaging Het
Metap1 T C 3: 138,180,824 (GRCm39) E119G possibly damaging Het
Nbea T C 3: 55,908,059 (GRCm39) H1351R possibly damaging Het
Nim1k T C 13: 120,174,162 (GRCm39) D244G probably damaging Het
Npas1 C T 7: 16,193,110 (GRCm39) probably null Het
Pcdh15 A G 10: 74,386,322 (GRCm39) D1136G probably damaging Het
Pde6b A G 5: 108,575,508 (GRCm39) I657V probably benign Het
Pi4ka A G 16: 17,204,129 (GRCm39) V55A probably benign Het
Plxnb2 T C 15: 89,044,826 (GRCm39) N1173S probably damaging Het
Pramel23 C T 4: 143,424,584 (GRCm39) probably null Het
Ptpn13 T C 5: 103,681,273 (GRCm39) probably null Het
Ptprb A G 10: 116,182,772 (GRCm39) S1483G probably benign Het
Rbm48 G A 5: 3,640,300 (GRCm39) P360S probably damaging Het
Rbp3 G C 14: 33,677,253 (GRCm39) E400D probably benign Het
Resf1 T C 6: 149,227,706 (GRCm39) S251P possibly damaging Het
Rfpl4 A G 7: 5,113,669 (GRCm39) S165P possibly damaging Het
Scn9a A T 2: 66,314,900 (GRCm39) L1595Q probably damaging Het
Scp2 A T 4: 107,928,547 (GRCm39) V381D probably damaging Het
Sec24c G A 14: 20,740,841 (GRCm39) V620M probably damaging Het
Slc30a9 T C 5: 67,473,110 (GRCm39) Y65H probably damaging Het
Sp140l1 C T 1: 85,087,057 (GRCm39) probably null Het
Spag7 C T 11: 70,560,029 (GRCm39) A27T probably damaging Het
St6galnac6 A G 2: 32,505,036 (GRCm39) I181V possibly damaging Het
Tm9sf3 T C 19: 41,236,372 (GRCm39) M130V probably damaging Het
Ugt3a1 C T 15: 9,306,565 (GRCm39) S238F probably benign Het
Usp9y G A Y: 1,304,756 (GRCm39) L2363F probably damaging Het
Vmn1r34 T A 6: 66,614,123 (GRCm39) H205L probably damaging Het
Vps50 C A 6: 3,516,694 (GRCm39) Q59K probably benign Het
Zeb2 T A 2: 44,913,074 (GRCm39) D39V probably damaging Het
Zfp146 G A 7: 29,861,847 (GRCm39) T65I probably benign Het
Zfp36 T C 7: 28,077,116 (GRCm39) D264G probably benign Het
Other mutations in Sorcs1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00092:Sorcs1 APN 19 50,178,492 (GRCm39) missense probably damaging 1.00
IGL00983:Sorcs1 APN 19 50,164,566 (GRCm39) missense probably damaging 0.98
IGL01125:Sorcs1 APN 19 50,216,639 (GRCm39) missense probably damaging 1.00
IGL01320:Sorcs1 APN 19 50,276,517 (GRCm39) splice site probably benign
IGL01445:Sorcs1 APN 19 50,141,504 (GRCm39) missense probably damaging 1.00
IGL01682:Sorcs1 APN 19 50,169,944 (GRCm39) missense probably benign 0.43
IGL01799:Sorcs1 APN 19 50,218,647 (GRCm39) critical splice donor site probably null
IGL02044:Sorcs1 APN 19 50,276,597 (GRCm39) splice site probably benign
IGL02111:Sorcs1 APN 19 50,218,683 (GRCm39) missense probably benign 0.00
IGL02364:Sorcs1 APN 19 50,322,036 (GRCm39) missense probably damaging 1.00
IGL02378:Sorcs1 APN 19 50,171,109 (GRCm39) nonsense probably null
IGL02498:Sorcs1 APN 19 50,666,606 (GRCm39) missense probably benign
IGL02658:Sorcs1 APN 19 50,178,530 (GRCm39) missense probably damaging 1.00
IGL02939:Sorcs1 APN 19 50,666,368 (GRCm39) nonsense probably null
IGL02942:Sorcs1 APN 19 50,463,875 (GRCm39) missense probably damaging 1.00
IGL03057:Sorcs1 APN 19 50,248,194 (GRCm39) nonsense probably null
IGL03230:Sorcs1 APN 19 50,230,531 (GRCm39) missense probably damaging 1.00
P0033:Sorcs1 UTSW 19 50,141,345 (GRCm39) missense probably damaging 0.98
R0109:Sorcs1 UTSW 19 50,367,329 (GRCm39) splice site probably benign
R0115:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0242:Sorcs1 UTSW 19 50,216,659 (GRCm39) missense probably damaging 1.00
R0325:Sorcs1 UTSW 19 50,301,480 (GRCm39) splice site probably null
R0481:Sorcs1 UTSW 19 50,624,891 (GRCm39) intron probably benign
R0581:Sorcs1 UTSW 19 50,241,139 (GRCm39) missense possibly damaging 0.70
R0669:Sorcs1 UTSW 19 50,230,380 (GRCm39) splice site probably benign
R0980:Sorcs1 UTSW 19 50,220,761 (GRCm39) missense probably benign 0.04
R1158:Sorcs1 UTSW 19 50,132,598 (GRCm39) unclassified probably benign
R1519:Sorcs1 UTSW 19 50,241,025 (GRCm39) missense probably benign 0.05
R1669:Sorcs1 UTSW 19 50,463,860 (GRCm39) missense probably damaging 0.99
R1779:Sorcs1 UTSW 19 50,163,481 (GRCm39) splice site probably benign
R1783:Sorcs1 UTSW 19 50,216,747 (GRCm39) critical splice acceptor site probably null
R1927:Sorcs1 UTSW 19 50,210,633 (GRCm39) missense probably damaging 1.00
R1935:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R1936:Sorcs1 UTSW 19 50,221,082 (GRCm39) missense probably damaging 0.96
R2109:Sorcs1 UTSW 19 50,666,630 (GRCm39) missense probably benign
R2206:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R2207:Sorcs1 UTSW 19 50,218,655 (GRCm39) missense possibly damaging 0.81
R3031:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3032:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3107:Sorcs1 UTSW 19 50,199,088 (GRCm39) missense possibly damaging 0.83
R3508:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R3738:Sorcs1 UTSW 19 50,139,659 (GRCm39) missense probably benign 0.03
R4127:Sorcs1 UTSW 19 50,210,597 (GRCm39) missense probably benign 0.29
R4212:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4213:Sorcs1 UTSW 19 50,213,613 (GRCm39) missense probably damaging 0.98
R4424:Sorcs1 UTSW 19 50,367,379 (GRCm39) missense probably damaging 0.97
R4603:Sorcs1 UTSW 19 50,301,402 (GRCm39) critical splice donor site probably null
R4679:Sorcs1 UTSW 19 50,171,107 (GRCm39) missense probably benign
R4780:Sorcs1 UTSW 19 50,132,419 (GRCm39) unclassified probably benign
R4781:Sorcs1 UTSW 19 50,171,119 (GRCm39) missense probably damaging 1.00
R4823:Sorcs1 UTSW 19 50,218,740 (GRCm39) missense possibly damaging 0.87
R4823:Sorcs1 UTSW 19 50,666,578 (GRCm39) missense possibly damaging 0.92
R4883:Sorcs1 UTSW 19 50,220,741 (GRCm39) missense probably benign 0.00
R5091:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
R5105:Sorcs1 UTSW 19 50,213,579 (GRCm39) missense possibly damaging 0.57
R5437:Sorcs1 UTSW 19 50,241,040 (GRCm39) missense probably benign 0.19
R5574:Sorcs1 UTSW 19 50,210,571 (GRCm39) missense probably damaging 1.00
R5734:Sorcs1 UTSW 19 50,171,213 (GRCm39) missense probably benign 0.04
R6045:Sorcs1 UTSW 19 50,178,555 (GRCm39) nonsense probably null
R6091:Sorcs1 UTSW 19 50,276,539 (GRCm39) missense possibly damaging 0.64
R6119:Sorcs1 UTSW 19 50,276,532 (GRCm39) missense probably damaging 0.98
R6226:Sorcs1 UTSW 19 50,169,852 (GRCm39) missense probably damaging 1.00
R6337:Sorcs1 UTSW 19 50,132,562 (GRCm39) missense probably benign 0.00
R6378:Sorcs1 UTSW 19 50,213,615 (GRCm39) missense possibly damaging 0.57
R6782:Sorcs1 UTSW 19 50,164,560 (GRCm39) nonsense probably null
R6792:Sorcs1 UTSW 19 50,666,606 (GRCm39) missense probably benign
R6891:Sorcs1 UTSW 19 50,213,557 (GRCm39) nonsense probably null
R7151:Sorcs1 UTSW 19 50,301,420 (GRCm39) missense probably damaging 1.00
R7223:Sorcs1 UTSW 19 50,178,480 (GRCm39) missense probably benign 0.06
R7356:Sorcs1 UTSW 19 50,163,595 (GRCm39) missense possibly damaging 0.86
R7471:Sorcs1 UTSW 19 50,250,701 (GRCm39) missense probably damaging 1.00
R7474:Sorcs1 UTSW 19 50,141,550 (GRCm39) missense possibly damaging 0.65
R7503:Sorcs1 UTSW 19 50,141,490 (GRCm39) missense probably benign
R7506:Sorcs1 UTSW 19 50,171,112 (GRCm39) nonsense probably null
R7573:Sorcs1 UTSW 19 50,141,234 (GRCm39) nonsense probably null
R7867:Sorcs1 UTSW 19 50,218,698 (GRCm39) nonsense probably null
R7911:Sorcs1 UTSW 19 50,132,470 (GRCm39) missense unknown
R8032:Sorcs1 UTSW 19 50,463,846 (GRCm39) missense probably benign 0.28
R8063:Sorcs1 UTSW 19 50,132,415 (GRCm39) missense unknown
R8463:Sorcs1 UTSW 19 50,248,248 (GRCm39) missense probably damaging 1.00
R8682:Sorcs1 UTSW 19 50,367,398 (GRCm39) missense probably damaging 0.99
R8724:Sorcs1 UTSW 19 50,139,658 (GRCm39) missense probably benign 0.33
R8926:Sorcs1 UTSW 19 50,241,096 (GRCm39) missense possibly damaging 0.94
R9160:Sorcs1 UTSW 19 50,213,658 (GRCm39) missense probably damaging 1.00
R9173:Sorcs1 UTSW 19 50,220,753 (GRCm39) missense possibly damaging 0.92
R9203:Sorcs1 UTSW 19 50,250,733 (GRCm39) missense probably damaging 1.00
R9229:Sorcs1 UTSW 19 50,141,300 (GRCm39) missense probably benign 0.17
R9398:Sorcs1 UTSW 19 50,213,651 (GRCm39) missense possibly damaging 0.90
R9430:Sorcs1 UTSW 19 50,199,208 (GRCm39) missense probably damaging 1.00
R9510:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9511:Sorcs1 UTSW 19 50,666,521 (GRCm39) missense probably benign 0.04
R9744:Sorcs1 UTSW 19 50,215,275 (GRCm39) missense probably damaging 1.00
R9777:Sorcs1 UTSW 19 50,248,190 (GRCm39) critical splice donor site probably null
X0024:Sorcs1 UTSW 19 50,171,201 (GRCm39) missense possibly damaging 0.92
Z1088:Sorcs1 UTSW 19 50,210,581 (GRCm39) missense probably benign 0.16
Z1177:Sorcs1 UTSW 19 50,322,037 (GRCm39) missense probably damaging 1.00
Z1177:Sorcs1 UTSW 19 50,215,180 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- ACGCTATTCAAGGTAGGTCAATAAG -3'
(R):5'- TGCGAGTTTGCCTTAGATAGTATTC -3'

Sequencing Primer
(F):5'- TCAAGGTAGGTCAATAAGTCAACAAC -3'
(R):5'- AGCAAAGTACTTAATTGTTACAGGG -3'
Posted On 2015-07-06