Mutagenetix > Incidental Mutation

Incidental Mutation 'R4386:Kirrel1'

326212

Institutional Source

Beutler Lab

Gene Symbol

Kirrel1

Ensembl Gene

ENSMUSG00000041734

Gene Name

kirre like nephrin family adhesion molecule 1

Synonyms

6720469N11Rik, Neph1, Kirrel1, Kirrel

MMRRC Submission

041680-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R4386 (G1)

Quality Score

225

Status

Validated

Chromosome

Chromosomal Location

86985900-87082054 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 86996458 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Methionine to Isoleucine at position 380 (M380I)

Ref Sequence

ENSEMBL: ENSMUSP00000125525 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000041732] [ENSMUST00000107618] [ENSMUST00000159976]

AlphaFold

Q80W68

Predicted Effect

probably null
Transcript: ENSMUST00000041732
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000043756
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000107618
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000103243
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000159976
AA Change: M380I

PolyPhen 2 Score 0.461 (Sensitivity: 0.89; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000125525
Gene: ENSMUSG00000041734
AA Change: M380I

Domain	Start	End	E-Value	Type
IG	59	149	3.62e-10	SMART
IG_like	160	252	1.27e1	SMART
IG_like	261	337	1.89e1	SMART
IGc2	352	410	3.28e-8	SMART
IG_like	430	522	5.71e0	SMART
transmembrane domain	529	551	N/A	INTRINSIC
low complexity region	694	712	N/A	INTRINSIC

Meta Mutation Damage Score

0.0922

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.1%
20x: 94.8%

Validation Efficiency

100% (48/48)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] NEPH1 is a member of the nephrin-like protein family, which includes NEPH2 (MIM 607761) and NEPH3 (MIM 607762). The cytoplasmic domains of these proteins interact with the C terminus of podocin (NPHS2; MIM 604766), and the genes are expressed in kidney podocytes, cells involved in ensuring size- and charge-selective ultrafiltration (Sellin et al., 2003 [PubMed 12424224]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trap insertion exhibit postnatal lethality and are small and sickly. Glomerular and tubular defects in the kidney result in severe proteinuria. [provided by MGI curators]

Allele List at MGI

All alleles(121) : Targeted, other(2) Gene trapped(119)

Other mutations in this stock

Total: 47 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acacb	A	T	5: 114,379,982 (GRCm39)		probably null	Het
Acsm3	G	T	7: 119,373,094 (GRCm39)	W199L	probably damaging	Het
Arap1	T	A	7: 101,034,778 (GRCm39)	D236E	probably benign	Het
Arhgap1	T	C	2: 91,498,582 (GRCm39)	Y160H	probably damaging	Het
Arid1b	A	G	17: 5,045,247 (GRCm39)		probably benign	Het
Cdc25a	A	G	9: 109,718,801 (GRCm39)	E334G	probably damaging	Het
Ciz1	C	T	2: 32,260,111 (GRCm39)	T219M	possibly damaging	Het
Cluap1	A	C	16: 3,751,586 (GRCm39)	D315A	possibly damaging	Het
Cps1	T	C	1: 67,210,154 (GRCm39)		probably null	Het
Cul2	T	C	18: 3,434,856 (GRCm39)	S668P	probably damaging	Het
Fah	T	A	7: 84,248,344 (GRCm39)	T125S	probably damaging	Het
Fam221a	G	A	6: 49,355,366 (GRCm39)	C156Y	probably damaging	Het
Gm6158	G	T	14: 24,120,362 (GRCm39)		noncoding transcript	Het
Hbq1b	T	A	11: 32,237,295 (GRCm39)	V63E	probably damaging	Het
Ighv6-5	G	A	12: 114,380,337 (GRCm39)	T79I	possibly damaging	Het
Kif12	G	A	4: 63,089,455 (GRCm39)	T99M	probably damaging	Het
Kif1a	T	A	1: 92,996,272 (GRCm39)	K298M	probably damaging	Het
Lama1	A	G	17: 68,080,707 (GRCm39)	Q1245R	probably benign	Het
Marchf4	G	A	1: 72,467,973 (GRCm39)	P353L	probably benign	Het
Nadk	A	T	4: 155,667,032 (GRCm39)		probably benign	Het
Ncoa2	T	C	1: 13,247,389 (GRCm39)	T345A	probably damaging	Het
Niban3	A	G	8: 72,060,155 (GRCm39)		probably benign	Het
Nsun6	T	A	2: 15,001,333 (GRCm39)	M408L	probably benign	Het
Nuak1	T	A	10: 84,229,908 (GRCm39)	E155V	probably damaging	Het
Oosp1	C	T	19: 11,645,158 (GRCm39)	V169I	possibly damaging	Het
Or13c7c	C	T	4: 43,836,124 (GRCm39)	R122H	probably benign	Het
Or2t26	T	A	11: 49,039,842 (GRCm39)	Y253N	probably damaging	Het
Or5ae2	T	C	7: 84,505,756 (GRCm39)	Y60H	probably damaging	Het
Or5p81	T	A	7: 108,267,460 (GRCm39)	V279E	probably damaging	Het
Pabpc2	T	C	18: 39,908,238 (GRCm39)	V501A	probably benign	Het
Pik3c2a	A	G	7: 115,953,334 (GRCm39)	V1187A	probably damaging	Het
Pkhd1	A	G	1: 20,484,516 (GRCm39)	V2013A	probably benign	Het
Psmd1	T	A	1: 86,055,914 (GRCm39)	S759T	possibly damaging	Het
Scgb1b2	T	A	7: 30,990,089 (GRCm39)	K86N	possibly damaging	Het
Sdk1	T	C	5: 142,080,381 (GRCm39)	I1291T	probably damaging	Het
Skint5	T	C	4: 113,341,090 (GRCm39)	Y1396C	probably benign	Het
Slc24a3	A	G	2: 145,448,746 (GRCm39)	E380G	probably benign	Het
Spock1	A	G	13: 57,588,263 (GRCm39)	S270P	probably damaging	Het
Tmem128	T	C	5: 38,419,418 (GRCm39)	S57P	probably damaging	Het
Tmem186	G	A	16: 8,453,887 (GRCm39)	R125W	probably benign	Het
Tnfaip3	A	G	10: 18,882,758 (GRCm39)	S220P	probably damaging	Het
Usp45	T	C	4: 21,830,505 (GRCm39)		probably null	Het
Usp5	C	T	6: 124,795,437 (GRCm39)		probably null	Het
Vmn1r35	A	T	6: 66,656,573 (GRCm39)	C32*	probably null	Het
Vmn2r112	T	A	17: 22,820,303 (GRCm39)	F59I	probably benign	Het
Wfdc9	A	T	2: 164,492,458 (GRCm39)	S56R	probably benign	Het
Zfp369	A	G	13: 65,444,806 (GRCm39)	I650V	probably benign	Het

Other mutations in Kirrel1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01310:Kirrel1	APN	3	86,997,182 (GRCm39)	missense	probably benign	0.22
IGL01865:Kirrel1	APN	3	86,993,731 (GRCm39)	missense	probably damaging	1.00
IGL01875:Kirrel1	APN	3	87,003,037 (GRCm39)	missense	probably damaging	1.00
IGL02337:Kirrel1	APN	3	86,996,519 (GRCm39)	missense	possibly damaging	0.64
IGL02724:Kirrel1	APN	3	86,997,780 (GRCm39)	nonsense	probably null
IGL02825:Kirrel1	APN	3	86,996,595 (GRCm39)	splice site	probably benign
IGL02826:Kirrel1	APN	3	86,995,792 (GRCm39)	missense	probably damaging	1.00
IGL03102:Kirrel1	APN	3	86,990,807 (GRCm39)	missense	probably damaging	0.98
D4043:Kirrel1	UTSW	3	86,990,510 (GRCm39)	missense	probably benign	0.02
R0360:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0364:Kirrel1	UTSW	3	86,997,106 (GRCm39)	missense	probably damaging	1.00
R0421:Kirrel1	UTSW	3	86,990,914 (GRCm39)	missense	probably damaging	0.99
R0503:Kirrel1	UTSW	3	87,005,109 (GRCm39)	missense	probably benign	0.20
R1112:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1116:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1144:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1147:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1190:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1226:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1501:Kirrel1	UTSW	3	86,997,779 (GRCm39)	missense	probably benign	0.02
R1538:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1546:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1628:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1630:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1631:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1664:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1671:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1695:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1769:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1807:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1808:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1840:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R1995:Kirrel1	UTSW	3	87,003,093 (GRCm39)	missense	possibly damaging	0.88
R2014:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2086:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2108:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2354:Kirrel1	UTSW	3	86,995,792 (GRCm39)	missense	probably damaging	0.98
R2407:Kirrel1	UTSW	3	86,992,150 (GRCm39)	missense	probably benign	0.03
R2904:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2905:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2958:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2959:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2960:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R2961:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3026:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3028:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3034:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R3149:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3195:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3196:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3499:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3699:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3720:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3721:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3788:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3793:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3876:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3877:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3901:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3910:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3911:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3912:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3913:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3930:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R3931:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4022:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4067:Kirrel1	UTSW	3	86,995,774 (GRCm39)	nonsense	probably null
R4077:Kirrel1	UTSW	3	86,992,387 (GRCm39)	critical splice donor site	probably null
R4198:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4328:Kirrel1	UTSW	3	86,992,081 (GRCm39)	intron	probably benign
R4355:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4363:Kirrel1	UTSW	3	86,997,792 (GRCm39)	nonsense	probably null
R4378:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4460:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4468:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4469:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4650:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4652:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4734:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4748:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R4749:Kirrel1	UTSW	3	86,996,458 (GRCm39)	missense	probably null	0.46
R5304:Kirrel1	UTSW	3	86,996,902 (GRCm39)	missense	probably benign	0.02
R5534:Kirrel1	UTSW	3	86,997,825 (GRCm39)	missense	probably damaging	1.00
R5604:Kirrel1	UTSW	3	86,996,462 (GRCm39)	missense	possibly damaging	0.69
R7199:Kirrel1	UTSW	3	86,990,695 (GRCm39)	missense	probably benign	0.02
R7221:Kirrel1	UTSW	3	86,993,704 (GRCm39)	nonsense	probably null
R7284:Kirrel1	UTSW	3	86,990,694 (GRCm39)	missense	probably benign	0.02
R7332:Kirrel1	UTSW	3	86,995,705 (GRCm39)	missense	probably benign	0.14
R7369:Kirrel1	UTSW	3	87,048,391 (GRCm39)	missense	probably benign	0.20
R7371:Kirrel1	UTSW	3	86,995,729 (GRCm39)	missense	probably benign	0.44
R7508:Kirrel1	UTSW	3	86,990,746 (GRCm39)	missense	possibly damaging	0.56
R7566:Kirrel1	UTSW	3	86,995,791 (GRCm39)	missense	probably damaging	1.00
R7567:Kirrel1	UTSW	3	87,002,988 (GRCm39)	missense	probably damaging	0.99
R7621:Kirrel1	UTSW	3	86,995,528 (GRCm39)	missense	possibly damaging	0.70
R8030:Kirrel1	UTSW	3	87,005,082 (GRCm39)	missense	probably damaging	1.00
R8141:Kirrel1	UTSW	3	86,993,735 (GRCm39)	nonsense	probably null
R8261:Kirrel1	UTSW	3	86,995,309 (GRCm39)	intron	probably benign
R8477:Kirrel1	UTSW	3	86,992,138 (GRCm39)	missense	possibly damaging	0.71
R8512:Kirrel1	UTSW	3	86,995,534 (GRCm39)	missense	probably benign	0.00
R8954:Kirrel1	UTSW	3	86,997,173 (GRCm39)	missense	probably benign	0.25
R8987:Kirrel1	UTSW	3	86,992,400 (GRCm39)	missense	probably damaging	1.00
R9058:Kirrel1	UTSW	3	86,992,442 (GRCm39)	missense	probably benign	0.18
R9146:Kirrel1	UTSW	3	87,003,015 (GRCm39)	missense	probably damaging	1.00
R9311:Kirrel1	UTSW	3	87,005,123 (GRCm39)	missense	probably benign	0.29
R9527:Kirrel1	UTSW	3	86,996,912 (GRCm39)	nonsense	probably null
R9629:Kirrel1	UTSW	3	87,003,025 (GRCm39)	nonsense	probably null
Z1177:Kirrel1	UTSW	3	86,991,182 (GRCm39)	nonsense	probably null

Predicted Primers

PCR Primer
(F):5'- TCACCCTGAGTTCTATGCAAGTC -3'
(R):5'- AGCTGATGATTCTCAGGCACC -3'

Sequencing Primer
(F):5'- TATGGCTGACTGCAAGTACC -3'
(R):5'- TCAGGCACCTGAGACTCTGAC -3'

Posted On

2015-07-06