Incidental Mutation 'R4386:Tnfaip3'
ID326232
Institutional Source Beutler Lab
Gene Symbol Tnfaip3
Ensembl Gene ENSMUSG00000019850
Gene Nametumor necrosis factor, alpha-induced protein 3
SynonymsA20, zinc finger protein A20, Tnfip3
MMRRC Submission 041680-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4386 (G1)
Quality Score225
Status Validated
Chromosome10
Chromosomal Location19000910-19015657 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 19007010 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 220 (S220P)
Ref Sequence ENSEMBL: ENSMUSP00000101167 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019997] [ENSMUST00000105527] [ENSMUST00000122863] [ENSMUST00000146388]
Predicted Effect probably damaging
Transcript: ENSMUST00000019997
AA Change: S220P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000019997
Gene: ENSMUSG00000019850
AA Change: S220P

DomainStartEndE-ValueType
Pfam:OTU 98 257 1.2e-30 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000105527
AA Change: S220P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101167
Gene: ENSMUSG00000019850
AA Change: S220P

DomainStartEndE-ValueType
Pfam:OTU 98 257 7.8e-34 PFAM
ZnF_A20 384 409 8.06e-9 SMART
low complexity region 425 436 N/A INTRINSIC
ZnF_A20 467 492 3.76e-9 SMART
ZnF_A20 503 526 4.74e-6 SMART
low complexity region 528 543 N/A INTRINSIC
ZnF_A20 589 614 6.01e-8 SMART
ZnF_A20 639 664 1.56e-6 SMART
ZnF_A20 698 723 1.68e-6 SMART
ZnF_A20 744 769 2.81e-8 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122863
SMART Domains Protein: ENSMUSP00000116318
Gene: ENSMUSG00000019850

DomainStartEndE-ValueType
PDB:2VFJ|D 1 122 2e-83 PDB
SCOP:d1e3ha3 18 109 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000146388
SMART Domains Protein: ENSMUSP00000120627
Gene: ENSMUSG00000019850

DomainStartEndE-ValueType
PDB:3ZJG|B 1 87 1e-56 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154749
Meta Mutation Damage Score 0.362 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (48/48)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene was identified as a gene whose expression is rapidly induced by the tumor necrosis factor (TNF). The protein encoded by this gene is a zinc finger protein and ubiqitin-editing enzyme, and has been shown to inhibit NF-kappa B activation as well as TNF-mediated apoptosis. The encoded protein, which has both ubiquitin ligase and deubiquitinase activities, is involved in the cytokine-mediated immune and inflammatory responses. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jul 2012]
PHENOTYPE: Homozygous null mice display runting, severe multi-organ inflammation, hypersensitivity to lipopolysaccharide and TNF, and premature death. Older mice homozygous for point mutations that disrupt deubiquitinating activity develop splenomegaly and show an increased number of myeloid cells. [provided by MGI curators]
Allele List at MGI

All alleles(4) : Targeted, knock-out(2) Targeted, other(2)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,241,921 probably null Het
Acsm3 G T 7: 119,773,871 W199L probably damaging Het
Arap1 T A 7: 101,385,571 D236E probably benign Het
Arhgap1 T C 2: 91,668,237 Y160H probably damaging Het
Arid1b A G 17: 4,994,972 probably benign Het
Cdc25a A G 9: 109,889,733 E334G probably damaging Het
Ciz1 C T 2: 32,370,099 T219M possibly damaging Het
Cluap1 A C 16: 3,933,722 D315A possibly damaging Het
Cps1 T C 1: 67,170,995 probably null Het
Cul2 T C 18: 3,434,856 S668P probably damaging Het
Fah T A 7: 84,599,136 T125S probably damaging Het
Fam129c A G 8: 71,607,511 probably benign Het
Fam221a G A 6: 49,378,432 C156Y probably damaging Het
Gm6158 G T 14: 24,070,294 noncoding transcript Het
Hbq1b T A 11: 32,287,295 V63E probably damaging Het
Ighv6-5 G A 12: 114,416,717 T79I possibly damaging Het
Kif12 G A 4: 63,171,218 T99M probably damaging Het
Kif1a T A 1: 93,068,550 K298M probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
March4 G A 1: 72,428,814 P353L probably benign Het
Nadk A T 4: 155,582,575 probably benign Het
Ncoa2 T C 1: 13,177,165 T345A probably damaging Het
Nsun6 T A 2: 14,996,522 M408L probably benign Het
Nuak1 T A 10: 84,394,044 E155V probably damaging Het
Olfr1395 T A 11: 49,149,015 Y253N probably damaging Het
Olfr157 C T 4: 43,836,124 R122H probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr510 T A 7: 108,668,253 V279E probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Pabpc2 T C 18: 39,775,185 V501A probably benign Het
Pik3c2a A G 7: 116,354,099 V1187A probably damaging Het
Pkhd1 A G 1: 20,414,292 V2013A probably benign Het
Psmd1 T A 1: 86,128,192 S759T possibly damaging Het
Scgb1b2 T A 7: 31,290,664 K86N possibly damaging Het
Sdk1 T C 5: 142,094,626 I1291T probably damaging Het
Skint5 T C 4: 113,483,893 Y1396C probably benign Het
Slc24a3 A G 2: 145,606,826 E380G probably benign Het
Spock1 A G 13: 57,440,450 S270P probably damaging Het
Tmem128 T C 5: 38,262,074 S57P probably damaging Het
Tmem186 G A 16: 8,636,023 R125W probably benign Het
Usp45 T C 4: 21,830,505 probably null Het
Usp5 C T 6: 124,818,474 probably null Het
Vmn1r35 A T 6: 66,679,589 C32* probably null Het
Vmn2r112 T A 17: 22,601,322 F59I probably benign Het
Wfdc9 A T 2: 164,650,538 S56R probably benign Het
Zfp369 A G 13: 65,296,992 I650V probably benign Het
Other mutations in Tnfaip3
AlleleSourceChrCoordTypePredicted EffectPPH Score
lasvegas APN 10 19010758 unclassified probably benign
IGL00840:Tnfaip3 APN 10 19005126 missense probably damaging 1.00
IGL00966:Tnfaip3 APN 10 19005137 missense probably damaging 1.00
IGL01080:Tnfaip3 APN 10 19011655 missense probably benign 0.03
IGL01736:Tnfaip3 APN 10 19006901 missense probably damaging 1.00
IGL02318:Tnfaip3 APN 10 19004467 missense probably benign 0.04
IGL02703:Tnfaip3 APN 10 19007032 missense probably damaging 0.98
IGL03032:Tnfaip3 APN 10 19004609 missense probably benign
IGL03331:Tnfaip3 APN 10 19011601 missense possibly damaging 0.63
IGL03389:Tnfaip3 APN 10 19004987 missense probably benign 0.03
PIT4243001:Tnfaip3 UTSW 10 19011574 missense probably damaging 1.00
PIT4480001:Tnfaip3 UTSW 10 19007323 missense probably benign
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0044:Tnfaip3 UTSW 10 19011626 missense probably damaging 0.98
R0056:Tnfaip3 UTSW 10 19005293 missense probably damaging 1.00
R0195:Tnfaip3 UTSW 10 19005713 missense probably damaging 1.00
R0226:Tnfaip3 UTSW 10 19002747 missense probably damaging 1.00
R0369:Tnfaip3 UTSW 10 19006912 nonsense probably null
R0744:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R0833:Tnfaip3 UTSW 10 19002949 missense probably benign 0.09
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1469:Tnfaip3 UTSW 10 19008269 missense probably damaging 1.00
R1876:Tnfaip3 UTSW 10 19004934 missense possibly damaging 0.81
R1902:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1903:Tnfaip3 UTSW 10 19008189 missense probably benign 0.19
R1922:Tnfaip3 UTSW 10 19003607 missense possibly damaging 0.51
R1973:Tnfaip3 UTSW 10 19004504 missense probably damaging 0.98
R2040:Tnfaip3 UTSW 10 19008152 missense possibly damaging 0.89
R2513:Tnfaip3 UTSW 10 19005659 missense probably benign 0.00
R2936:Tnfaip3 UTSW 10 19011609 missense probably damaging 1.00
R3607:Tnfaip3 UTSW 10 19005602 missense probably damaging 1.00
R4483:Tnfaip3 UTSW 10 19011627 missense probably damaging 1.00
R4673:Tnfaip3 UTSW 10 19011832 intron probably benign
R4879:Tnfaip3 UTSW 10 19005573 missense probably benign 0.03
R5082:Tnfaip3 UTSW 10 19005284 missense probably damaging 1.00
R5524:Tnfaip3 UTSW 10 19008195 missense probably damaging 0.98
R6559:Tnfaip3 UTSW 10 19007248 missense probably damaging 1.00
R6776:Tnfaip3 UTSW 10 19005576 missense probably benign 0.02
R6853:Tnfaip3 UTSW 10 19003751 missense probably benign
R6891:Tnfaip3 UTSW 10 19011669 missense probably damaging 1.00
R7144:Tnfaip3 UTSW 10 19007281 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGGAACTCCAAGATCCATCAGG -3'
(R):5'- TCCTCAGAAGACCCATCATTGTC -3'

Sequencing Primer
(F):5'- TCCATCAGGATCATGAATAGGAACTG -3'
(R):5'- GACCCATCATTGTCATTTCAGGTGAG -3'
Posted On2015-07-06