Incidental Mutation 'R4386:Zfp369'
ID326239
Institutional Source Beutler Lab
Gene Symbol Zfp369
Ensembl Gene ENSMUSG00000021514
Gene Namezinc finger protein 369
SynonymsB930030B22Rik, NRIF2, D230020H11Rik
MMRRC Submission 041680-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.189) question?
Stock #R4386 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location65278814-65304221 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 65296992 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 650 (I650V)
Ref Sequence ENSEMBL: ENSMUSP00000119114 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000126879] [ENSMUST00000130799]
Predicted Effect probably benign
Transcript: ENSMUST00000126879
AA Change: I650V

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000119114
Gene: ENSMUSG00000021514
AA Change: I650V

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 367 1.63e-14 SMART
low complexity region 440 452 N/A INTRINSIC
ZnF_C2H2 701 723 5.42e-2 SMART
ZnF_C2H2 729 751 4.79e-3 SMART
ZnF_C2H2 757 779 1.47e-3 SMART
ZnF_C2H2 785 807 2.43e-4 SMART
ZnF_C2H2 813 835 6.88e-4 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000130799
SMART Domains Protein: ENSMUSP00000116221
Gene: ENSMUSG00000021514

DomainStartEndE-ValueType
KRAB 35 95 7.13e-20 SMART
SCAN 178 289 2.57e-39 SMART
KRAB 300 354 3.54e-15 SMART
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,241,921 probably null Het
Acsm3 G T 7: 119,773,871 W199L probably damaging Het
Arap1 T A 7: 101,385,571 D236E probably benign Het
Arhgap1 T C 2: 91,668,237 Y160H probably damaging Het
Arid1b A G 17: 4,994,972 probably benign Het
Cdc25a A G 9: 109,889,733 E334G probably damaging Het
Ciz1 C T 2: 32,370,099 T219M possibly damaging Het
Cluap1 A C 16: 3,933,722 D315A possibly damaging Het
Cps1 T C 1: 67,170,995 probably null Het
Cul2 T C 18: 3,434,856 S668P probably damaging Het
Fah T A 7: 84,599,136 T125S probably damaging Het
Fam129c A G 8: 71,607,511 probably benign Het
Fam221a G A 6: 49,378,432 C156Y probably damaging Het
Gm6158 G T 14: 24,070,294 noncoding transcript Het
Hbq1b T A 11: 32,287,295 V63E probably damaging Het
Ighv6-5 G A 12: 114,416,717 T79I possibly damaging Het
Kif12 G A 4: 63,171,218 T99M probably damaging Het
Kif1a T A 1: 93,068,550 K298M probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
March4 G A 1: 72,428,814 P353L probably benign Het
Nadk A T 4: 155,582,575 probably benign Het
Ncoa2 T C 1: 13,177,165 T345A probably damaging Het
Nsun6 T A 2: 14,996,522 M408L probably benign Het
Nuak1 T A 10: 84,394,044 E155V probably damaging Het
Olfr1395 T A 11: 49,149,015 Y253N probably damaging Het
Olfr157 C T 4: 43,836,124 R122H probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr510 T A 7: 108,668,253 V279E probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Pabpc2 T C 18: 39,775,185 V501A probably benign Het
Pik3c2a A G 7: 116,354,099 V1187A probably damaging Het
Pkhd1 A G 1: 20,414,292 V2013A probably benign Het
Psmd1 T A 1: 86,128,192 S759T possibly damaging Het
Scgb1b2 T A 7: 31,290,664 K86N possibly damaging Het
Sdk1 T C 5: 142,094,626 I1291T probably damaging Het
Skint5 T C 4: 113,483,893 Y1396C probably benign Het
Slc24a3 A G 2: 145,606,826 E380G probably benign Het
Spock1 A G 13: 57,440,450 S270P probably damaging Het
Tmem128 T C 5: 38,262,074 S57P probably damaging Het
Tmem186 G A 16: 8,636,023 R125W probably benign Het
Tnfaip3 A G 10: 19,007,010 S220P probably damaging Het
Usp45 T C 4: 21,830,505 probably null Het
Usp5 C T 6: 124,818,474 probably null Het
Vmn1r35 A T 6: 66,679,589 C32* probably null Het
Vmn2r112 T A 17: 22,601,322 F59I probably benign Het
Wfdc9 A T 2: 164,650,538 S56R probably benign Het
Other mutations in Zfp369
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00969:Zfp369 APN 13 65297260 missense probably benign 0.41
IGL01393:Zfp369 APN 13 65294474 missense possibly damaging 0.85
IGL02277:Zfp369 APN 13 65284932 missense probably damaging 1.00
IGL02986:Zfp369 APN 13 65280281 missense probably damaging 1.00
IGL02992:Zfp369 APN 13 65294451 missense possibly damaging 0.50
IGL03170:Zfp369 APN 13 65294410 missense probably damaging 0.99
IGL03351:Zfp369 APN 13 65296153 missense possibly damaging 0.95
R0136:Zfp369 UTSW 13 65297202 missense probably benign 0.08
R0600:Zfp369 UTSW 13 65296434 missense probably damaging 0.97
R0646:Zfp369 UTSW 13 65297548 missense probably damaging 1.00
R1190:Zfp369 UTSW 13 65292293 missense probably damaging 0.99
R1191:Zfp369 UTSW 13 65291962 nonsense probably null
R1528:Zfp369 UTSW 13 65292165 missense probably damaging 1.00
R1934:Zfp369 UTSW 13 65297151 missense probably damaging 1.00
R2168:Zfp369 UTSW 13 65296948 missense probably benign 0.01
R4928:Zfp369 UTSW 13 65296800 missense possibly damaging 0.91
R5127:Zfp369 UTSW 13 65279033 start gained probably benign
R5549:Zfp369 UTSW 13 65297380 missense probably damaging 1.00
R5740:Zfp369 UTSW 13 65296767 missense probably benign
R5743:Zfp369 UTSW 13 65295680 missense probably benign 0.02
R5840:Zfp369 UTSW 13 65297278 missense possibly damaging 0.46
R6351:Zfp369 UTSW 13 65296230 missense possibly damaging 0.83
R7248:Zfp369 UTSW 13 65296117 missense probably damaging 0.98
R7288:Zfp369 UTSW 13 65285018 critical splice donor site probably null
R7314:Zfp369 UTSW 13 65292104 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GGGACAACAGCATCTTAACACATG -3'
(R):5'- GCTCTGAACAAATGCTTTCCC -3'

Sequencing Primer
(F):5'- CATGTAAAAATTCACCAGAAAGGC -3'
(R):5'- TACACATGTAAGGCCGCTCTC -3'
Posted On2015-07-06