Incidental Mutation 'R4386:Pabpc2'
ID326247
Institutional Source Beutler Lab
Gene Symbol Pabpc2
Ensembl Gene ENSMUSG00000051732
Gene Namepoly(A) binding protein, cytoplasmic 2
SynonymsPabp2
MMRRC Submission 041680-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4386 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location39773497-39776082 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 39775185 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 501 (V501A)
Ref Sequence ENSEMBL: ENSMUSP00000066639 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063219]
Predicted Effect probably benign
Transcript: ENSMUST00000063219
AA Change: V501A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000066639
Gene: ENSMUSG00000051732
AA Change: V501A

DomainStartEndE-ValueType
RRM 12 85 1.64e-19 SMART
RRM 100 171 7.57e-24 SMART
RRM 192 264 5.23e-27 SMART
RRM 295 366 3.53e-24 SMART
low complexity region 398 413 N/A INTRINSIC
low complexity region 490 500 N/A INTRINSIC
PolyA 546 609 1.69e-27 SMART
Meta Mutation Damage Score 0.1416 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.8%
Validation Efficiency 100% (48/48)
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acacb A T 5: 114,241,921 probably null Het
Acsm3 G T 7: 119,773,871 W199L probably damaging Het
Arap1 T A 7: 101,385,571 D236E probably benign Het
Arhgap1 T C 2: 91,668,237 Y160H probably damaging Het
Arid1b A G 17: 4,994,972 probably benign Het
Cdc25a A G 9: 109,889,733 E334G probably damaging Het
Ciz1 C T 2: 32,370,099 T219M possibly damaging Het
Cluap1 A C 16: 3,933,722 D315A possibly damaging Het
Cps1 T C 1: 67,170,995 probably null Het
Cul2 T C 18: 3,434,856 S668P probably damaging Het
Fah T A 7: 84,599,136 T125S probably damaging Het
Fam129c A G 8: 71,607,511 probably benign Het
Fam221a G A 6: 49,378,432 C156Y probably damaging Het
Gm6158 G T 14: 24,070,294 noncoding transcript Het
Hbq1b T A 11: 32,287,295 V63E probably damaging Het
Ighv6-5 G A 12: 114,416,717 T79I possibly damaging Het
Kif12 G A 4: 63,171,218 T99M probably damaging Het
Kif1a T A 1: 93,068,550 K298M probably damaging Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lama1 A G 17: 67,773,712 Q1245R probably benign Het
March4 G A 1: 72,428,814 P353L probably benign Het
Nadk A T 4: 155,582,575 probably benign Het
Ncoa2 T C 1: 13,177,165 T345A probably damaging Het
Nsun6 T A 2: 14,996,522 M408L probably benign Het
Nuak1 T A 10: 84,394,044 E155V probably damaging Het
Olfr1395 T A 11: 49,149,015 Y253N probably damaging Het
Olfr157 C T 4: 43,836,124 R122H probably benign Het
Olfr291 T C 7: 84,856,548 Y60H probably damaging Het
Olfr510 T A 7: 108,668,253 V279E probably damaging Het
Oosp1 C T 19: 11,667,794 V169I possibly damaging Het
Pik3c2a A G 7: 116,354,099 V1187A probably damaging Het
Pkhd1 A G 1: 20,414,292 V2013A probably benign Het
Psmd1 T A 1: 86,128,192 S759T possibly damaging Het
Scgb1b2 T A 7: 31,290,664 K86N possibly damaging Het
Sdk1 T C 5: 142,094,626 I1291T probably damaging Het
Skint5 T C 4: 113,483,893 Y1396C probably benign Het
Slc24a3 A G 2: 145,606,826 E380G probably benign Het
Spock1 A G 13: 57,440,450 S270P probably damaging Het
Tmem128 T C 5: 38,262,074 S57P probably damaging Het
Tmem186 G A 16: 8,636,023 R125W probably benign Het
Tnfaip3 A G 10: 19,007,010 S220P probably damaging Het
Usp45 T C 4: 21,830,505 probably null Het
Usp5 C T 6: 124,818,474 probably null Het
Vmn1r35 A T 6: 66,679,589 C32* probably null Het
Vmn2r112 T A 17: 22,601,322 F59I probably benign Het
Wfdc9 A T 2: 164,650,538 S56R probably benign Het
Zfp369 A G 13: 65,296,992 I650V probably benign Het
Other mutations in Pabpc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00963:Pabpc2 APN 18 39775337 missense possibly damaging 0.78
IGL01295:Pabpc2 APN 18 39774029 missense probably damaging 1.00
IGL02061:Pabpc2 APN 18 39774993 missense probably benign 0.01
IGL02104:Pabpc2 APN 18 39774883 missense possibly damaging 0.65
IGL02513:Pabpc2 APN 18 39775140 missense probably benign 0.08
R0201:Pabpc2 UTSW 18 39775307 missense probably benign 0.01
R0383:Pabpc2 UTSW 18 39775395 missense probably damaging 0.99
R0616:Pabpc2 UTSW 18 39773739 missense possibly damaging 0.94
R0727:Pabpc2 UTSW 18 39775134 missense probably benign 0.00
R1597:Pabpc2 UTSW 18 39773900 missense probably damaging 1.00
R1722:Pabpc2 UTSW 18 39775116 missense probably benign 0.08
R1818:Pabpc2 UTSW 18 39774110 missense probably damaging 1.00
R2230:Pabpc2 UTSW 18 39775070 missense probably benign 0.00
R3087:Pabpc2 UTSW 18 39774266 missense probably benign 0.02
R4080:Pabpc2 UTSW 18 39775530 missense possibly damaging 0.86
R4332:Pabpc2 UTSW 18 39775340 missense probably benign 0.05
R4445:Pabpc2 UTSW 18 39774200 missense probably damaging 1.00
R4718:Pabpc2 UTSW 18 39774503 missense probably benign
R4744:Pabpc2 UTSW 18 39774828 missense probably benign 0.07
R4748:Pabpc2 UTSW 18 39774269 nonsense probably null
R5085:Pabpc2 UTSW 18 39774582 missense probably damaging 1.00
R5113:Pabpc2 UTSW 18 39775383 missense probably benign 0.16
R5994:Pabpc2 UTSW 18 39773894 missense probably benign 0.18
R6216:Pabpc2 UTSW 18 39774719 missense probably damaging 1.00
R6239:Pabpc2 UTSW 18 39773838 missense probably damaging 1.00
R6355:Pabpc2 UTSW 18 39774392 missense probably damaging 0.97
X0024:Pabpc2 UTSW 18 39775397 nonsense probably null
Predicted Primers PCR Primer
(F):5'- TTGCTCAACCAAGGCCAAGTG -3'
(R):5'- AGCCTTTCACCCAGCATTTG -3'

Sequencing Primer
(F):5'- CAAGTGCTCGCTGGATTGCTC -3'
(R):5'- CATTTGCTTCGGCTCTTGAG -3'
Posted On2015-07-06