Incidental Mutation 'R4387:2210408I21Rik'
List |< first << previous [record 31 of 9592] next >> last >|
ID326282
Institutional Source Beutler Lab
Gene Symbol 2210408I21Rik
Ensembl Gene ENSMUSG00000071252
Gene NameRIKEN cDNA 2210408I21 gene
Synonyms
MMRRC Submission 041681-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.343) question?
Stock #R4387 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location77135540-77613784 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to A at 77316574 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000127449 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000168779]
Predicted Effect probably null
Transcript: ENSMUST00000168779
SMART Domains Protein: ENSMUSP00000127449
Gene: ENSMUSG00000071252

DomainStartEndE-ValueType
low complexity region 121 133 N/A INTRINSIC
low complexity region 151 164 N/A INTRINSIC
Pfam:DUF4495 515 832 1.6e-140 PFAM
low complexity region 1241 1255 N/A INTRINSIC
Meta Mutation Damage Score 0.428 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.5%
  • 10x: 97.1%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 40 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9930021J03Rik A G 19: 29,805,315 probably benign Het
Adprm C T 11: 67,038,193 R324K probably benign Het
AI481877 A T 4: 59,060,915 C953S possibly damaging Het
Calcr T A 6: 3,707,581 N240Y probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cp T C 3: 19,977,202 V601A probably damaging Het
Cyp2a5 A G 7: 26,841,054 D364G probably damaging Het
Eno4 T A 19: 58,953,208 V187D probably benign Het
Fbxl7 C A 15: 26,543,259 S434I probably damaging Het
Fbxw24 A T 9: 109,609,985 L174Q probably damaging Het
Fryl T A 5: 73,086,560 R91S possibly damaging Het
Gabrd A G 4: 155,388,932 probably null Het
Gtpbp2 A G 17: 46,166,358 D383G probably benign Het
Igf1r A G 7: 68,170,009 I356V probably benign Het
Kcnc1 C A 7: 46,397,702 R9S possibly damaging Het
Lipi T A 16: 75,573,955 I125F probably damaging Het
Meig1 T C 2: 3,409,241 E74G probably damaging Het
Mgat4d A T 8: 83,371,706 Q366L probably damaging Het
Mrpl1 A G 5: 96,238,919 N256D possibly damaging Het
Nlrp4e A G 7: 23,301,477 K66E probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nphp3 A G 9: 104,030,020 T740A possibly damaging Het
Olfr1080 T C 2: 86,553,954 T57A probably damaging Het
Olfr1090 T A 2: 86,754,120 D206V probably benign Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Pde5a T C 3: 122,729,352 I36T probably benign Het
Pign A T 1: 105,522,060 L914M possibly damaging Het
Ppm1b A G 17: 85,015,419 D382G probably benign Het
Psd3 T C 8: 68,000,761 Y282C probably damaging Het
Ptprt A T 2: 161,927,650 Y432N probably damaging Het
Rbbp6 T C 7: 122,997,311 probably null Het
Recql4 A G 15: 76,705,958 S659P probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slit3 T C 11: 35,684,048 V1063A probably benign Het
Spdye4a A G 5: 143,225,623 V62A probably benign Het
Ttc6 G A 12: 57,643,050 G509S probably benign Het
Ush2a C T 1: 188,443,431 T1242M probably benign Het
Wwc2 T C 8: 47,831,646 S1155G unknown Het
Zfp551 A T 7: 12,418,641 I55N probably damaging Het
Other mutations in 2210408I21Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00164:2210408I21Rik APN 13 77323358 splice site probably benign
IGL01154:2210408I21Rik APN 13 77281094 missense probably benign 0.01
IGL01461:2210408I21Rik APN 13 77281095 missense probably benign 0.25
IGL01624:2210408I21Rik APN 13 77193086 missense probably damaging 0.99
IGL02033:2210408I21Rik APN 13 77259876 missense possibly damaging 0.90
IGL02621:2210408I21Rik APN 13 77260031 missense possibly damaging 0.92
IGL02718:2210408I21Rik APN 13 77174872 missense probably damaging 1.00
IGL02823:2210408I21Rik APN 13 77261955 missense probably damaging 0.96
IGL02859:2210408I21Rik APN 13 77267699 missense possibly damaging 0.71
IGL03006:2210408I21Rik APN 13 77323772 critical splice donor site probably null
IGL03072:2210408I21Rik APN 13 77259997 missense probably benign
IGL03184:2210408I21Rik APN 13 77323451 missense possibly damaging 0.63
IGL03275:2210408I21Rik APN 13 77298555 missense possibly damaging 0.71
R0226:2210408I21Rik UTSW 13 77303425 missense possibly damaging 0.86
R0323:2210408I21Rik UTSW 13 77298555 missense possibly damaging 0.71
R0614:2210408I21Rik UTSW 13 77192663 missense probably benign 0.26
R0894:2210408I21Rik UTSW 13 77323607 missense probably benign 0.18
R1165:2210408I21Rik UTSW 13 77334287 missense probably benign 0.06
R1509:2210408I21Rik UTSW 13 77192647 missense probably benign
R1711:2210408I21Rik UTSW 13 77269920 missense possibly damaging 0.93
R1714:2210408I21Rik UTSW 13 77316360 missense possibly damaging 0.86
R1718:2210408I21Rik UTSW 13 77245370 intron probably benign
R1836:2210408I21Rik UTSW 13 77323374 missense probably benign 0.00
R1893:2210408I21Rik UTSW 13 77267809 missense possibly damaging 0.93
R2035:2210408I21Rik UTSW 13 77612642 makesense probably null
R2329:2210408I21Rik UTSW 13 77303325 missense probably benign 0.04
R2897:2210408I21Rik UTSW 13 77323521 missense probably benign 0.33
R3688:2210408I21Rik UTSW 13 77267849 missense possibly damaging 0.52
R4153:2210408I21Rik UTSW 13 77193173 missense probably benign 0.00
R4388:2210408I21Rik UTSW 13 77316574 critical splice donor site probably null
R4499:2210408I21Rik UTSW 13 77316527 missense possibly damaging 0.96
R4614:2210408I21Rik UTSW 13 77254256 intron probably null
R4798:2210408I21Rik UTSW 13 77323724 missense possibly damaging 0.96
R4943:2210408I21Rik UTSW 13 77245327 missense possibly damaging 0.86
R5045:2210408I21Rik UTSW 13 77267808 synonymous probably null
R5387:2210408I21Rik UTSW 13 77259973 missense probably benign 0.11
R5500:2210408I21Rik UTSW 13 77303389 missense probably benign 0.33
R5686:2210408I21Rik UTSW 13 77303314 missense possibly damaging 0.72
R6111:2210408I21Rik UTSW 13 77327902 missense possibly damaging 0.72
R6135:2210408I21Rik UTSW 13 77254216 missense probably damaging 0.98
R6188:2210408I21Rik UTSW 13 77183731 missense possibly damaging 0.53
R6388:2210408I21Rik UTSW 13 77262111 missense probably benign
R6588:2210408I21Rik UTSW 13 77192647 missense probably benign
R6632:2210408I21Rik UTSW 13 77281067 missense possibly damaging 0.86
R6638:2210408I21Rik UTSW 13 77303402 missense probably benign 0.07
R6755:2210408I21Rik UTSW 13 77327875 missense probably benign
R6971:2210408I21Rik UTSW 13 77193187 missense possibly damaging 0.90
X0066:2210408I21Rik UTSW 13 77183640 missense possibly damaging 0.72
Z1088:2210408I21Rik UTSW 13 77174891 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTGGCACTGATGGACTCTG -3'
(R):5'- AGGCAAGCTCATGTGAATTCTG -3'

Sequencing Primer
(F):5'- ACTCTGTAAAGGACACTGTGC -3'
(R):5'- GTACAGTGCTCAGTCCTGAAATC -3'
Posted On2015-07-06