Incidental Mutation 'R4389:Tec'
ID326331
Institutional Source Beutler Lab
Gene Symbol Tec
Ensembl Gene ENSMUSG00000029217
Gene Nametec protein tyrosine kinase
Synonyms
MMRRC Submission 041126-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R4389 (G1)
Quality Score224
Status Validated
Chromosome5
Chromosomal Location72755716-72868483 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72782007 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 222 (Y222H)
Ref Sequence ENSEMBL: ENSMUSP00000109224 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000071944] [ENSMUST00000073843] [ENSMUST00000113594] [ENSMUST00000126481] [ENSMUST00000138842] [ENSMUST00000149533]
Predicted Effect probably benign
Transcript: ENSMUST00000071944
AA Change: Y222H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000071836
Gene: ENSMUSG00000029217
AA Change: Y222H

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000073843
AA Change: Y222H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000073509
Gene: ENSMUSG00000029217
AA Change: Y222H

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 230 2.85e-3 SMART
SH2 222 313 9.96e-28 SMART
TyrKc 347 596 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000113594
AA Change: Y222H

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000109224
Gene: ENSMUSG00000029217
AA Change: Y222H

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
low complexity region 158 177 N/A INTRINSIC
SH3 181 237 7.06e-17 SMART
SH2 244 335 4.05e-28 SMART
TyrKc 369 618 2.13e-132 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000126481
SMART Domains Protein: ENSMUSP00000123606
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
PH 5 113 2.13e-17 SMART
BTK 113 149 1.79e-21 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000138842
SMART Domains Protein: ENSMUSP00000120155
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000149533
SMART Domains Protein: ENSMUSP00000123258
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
Pfam:PH 5 98 1.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000155342
SMART Domains Protein: ENSMUSP00000118980
Gene: ENSMUSG00000029217

DomainStartEndE-ValueType
BTK 2 33 8.62e-15 SMART
Meta Mutation Damage Score 0.144 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.6%
  • 20x: 92.6%
Validation Efficiency 87% (26/30)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the Tec family of non-receptor protein-tyrosine kinases containing a pleckstrin homology domain. Tec family kinases are involved in the intracellular signaling mechanisms of cytokine receptors, lymphocyte surface antigens, heterotrimeric G-protein coupled receptors, and integrin molecules. They are also key players in the regulation of the immune functions. Tec kinase is an integral component of T cell signaling and has a distinct role in T cell activation. This gene may be associated with myelodysplastic syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit a minor reduction in platetet aggregation in response to threshold concentrations of collagen-related peptide or collagen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 A C 11: 9,297,878 T2542P probably damaging Het
Adprm C T 11: 67,038,193 R324K probably benign Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cd209b A G 8: 3,925,960 L67P probably damaging Het
Cfap54 T A 10: 92,967,500 K1560M probably benign Het
Ctps T C 4: 120,558,790 D212G probably damaging Het
Ercc6 T A 14: 32,574,908 L1285* probably null Het
Gzma G T 13: 113,098,388 probably null Het
Kng2 T C 16: 23,024,868 I120M possibly damaging Het
Lhx3 C T 2: 26,201,090 probably benign Het
Mtfr1l T C 4: 134,532,642 probably benign Het
Ndufb4 T C 16: 37,647,670 N126S probably benign Het
Nlrp4e A G 7: 23,321,227 I380V probably benign Het
Nptn A G 9: 58,643,772 K361E probably damaging Het
Olfr262 A G 19: 12,241,139 V174A probably damaging Het
Orc2 T C 1: 58,474,861 D332G probably benign Het
Pcdha4 T C 18: 36,954,789 V675A probably benign Het
Rpl7a-ps3 G A 15: 36,308,283 noncoding transcript Het
Slc13a1 A T 6: 24,092,398 probably null Het
Ttll2 T A 17: 7,351,200 R443* probably null Het
Vmn1r66 A T 7: 10,274,788 L106* probably null Het
Zfp189 A G 4: 49,529,934 R346G probably damaging Het
Other mutations in Tec
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Tec APN 5 72768768 missense probably damaging 1.00
IGL00980:Tec APN 5 72786798 missense probably damaging 1.00
IGL01986:Tec APN 5 72782005 nonsense probably null
IGL02505:Tec APN 5 72789244 missense probably damaging 1.00
IGL02522:Tec APN 5 72789172 missense probably benign 0.01
IGL02527:Tec APN 5 72779415 splice site probably null
IGL03292:Tec APN 5 72757364 missense probably null 0.98
IGL02988:Tec UTSW 5 72768747 missense possibly damaging 0.95
R0254:Tec UTSW 5 72763556 splice site probably benign
R0254:Tec UTSW 5 72783738 missense probably benign 0.12
R0646:Tec UTSW 5 72823497 missense probably damaging 1.00
R1122:Tec UTSW 5 72779449 missense probably damaging 0.96
R1495:Tec UTSW 5 72786755 missense probably damaging 1.00
R1617:Tec UTSW 5 72782105 missense probably damaging 0.97
R3905:Tec UTSW 5 72760362 missense probably damaging 1.00
R3953:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3954:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3955:Tec UTSW 5 72782177 critical splice acceptor site probably null
R3981:Tec UTSW 5 72823599 utr 5 prime probably benign
R4061:Tec UTSW 5 72823409 unclassified probably benign
R4507:Tec UTSW 5 72760358 missense probably damaging 1.00
R4689:Tec UTSW 5 72823637 start gained probably benign
R4702:Tec UTSW 5 72783731 missense possibly damaging 0.71
R4776:Tec UTSW 5 72768776 missense probably benign 0.38
R4911:Tec UTSW 5 72756351 missense probably benign 0.05
R4923:Tec UTSW 5 72782022 nonsense probably null
R4932:Tec UTSW 5 72760393 nonsense probably null
R5595:Tec UTSW 5 72768744 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCAAACACCTGGAAGGAGGTAATTG -3'
(R):5'- TTTGCATAGAGAAGGCCTCCTC -3'

Sequencing Primer
(F):5'- AGCTACCCTTGAGTAGACCCTG -3'
(R):5'- GAGAAGGCCTCCTCCACCAATTC -3'
Posted On2015-07-06