Incidental Mutation 'R4392:Rad18'
ID326404
Institutional Source Beutler Lab
Gene Symbol Rad18
Ensembl Gene ENSMUSG00000030254
Gene NameRAD18 E3 ubiquitin protein ligase
Synonyms2810024C04Rik
MMRRC Submission 041127-MU
Accession Numbers

Genbank: NM_001167730, NM_021385; MGI: 1890476

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4392 (G1)
Quality Score225
Status Validated
Chromosome6
Chromosomal Location112619850-112696686 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 112693529 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 25 (C25S)
Ref Sequence ENSEMBL: ENSMUSP00000138558 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068487] [ENSMUST00000077088] [ENSMUST00000113180] [ENSMUST00000113182] [ENSMUST00000156063]
Predicted Effect probably damaging
Transcript: ENSMUST00000068487
AA Change: C25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000070619
Gene: ENSMUSG00000030254
AA Change: C25S

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
internal_repeat_1 398 422 2.94e-14 PROSPERO
internal_repeat_1 422 446 2.94e-14 PROSPERO
low complexity region 473 488 N/A INTRINSIC
low complexity region 495 507 N/A INTRINSIC
low complexity region 514 522 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000077088
AA Change: C25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076341
Gene: ENSMUSG00000030254
AA Change: C25S

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
PDB:2YBF|B 340 363 7e-6 PDB
internal_repeat_1 372 396 1.24e-14 PROSPERO
internal_repeat_1 396 420 1.24e-14 PROSPERO
low complexity region 447 462 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113180
AA Change: C25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108805
Gene: ENSMUSG00000030254
AA Change: C25S

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
low complexity region 366 381 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000113182
AA Change: C25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000108807
Gene: ENSMUSG00000030254
AA Change: C25S

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
low complexity region 366 381 N/A INTRINSIC
low complexity region 388 400 N/A INTRINSIC
low complexity region 407 415 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132590
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135092
Predicted Effect probably damaging
Transcript: ENSMUST00000156063
AA Change: C25S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138558
Gene: ENSMUSG00000030254
AA Change: C25S

DomainStartEndE-ValueType
RING 25 63 3.12e-6 SMART
low complexity region 99 116 N/A INTRINSIC
ZnF_Rad18 201 224 3.61e-10 SMART
SAP 248 282 2.71e-11 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000180959
Meta Mutation Damage Score 0.468 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is highly similar to S. cerevisiae DNA damage repair protein Rad18. Yeast Rad18 functions through its interaction with Rad6, which is an ubiquitin-conjugating enzyme required for post-replication repair of damaged DNA. Similar to its yeast counterpart, this protein is able to interact with the human homolog of yeast Rad6 protein through a conserved ring-finger motif. Mutation of this motif results in defective replication of UV-damaged DNA and hypersensitivity to multiple mutagens. [provided by RefSeq, Jul 2008]
PHENOTYPE: Male mice homozygous for a null allele exhibit age-dependent decrease in fertility, germ cell number, and testes weight with progressive degeneration of seminiferous tubules. [provided by MGI curators]
Allele List at MGI

 All alleles(6) : Targeted, knock-out(1) Targeted, other(1) Gene trapped(4)

Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Rad18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01577:Rad18 APN 6 112665341 splice site probably benign
IGL02425:Rad18 APN 6 112620898 missense probably damaging 1.00
IGL02622:Rad18 APN 6 112687987 missense probably damaging 0.99
IGL02814:Rad18 APN 6 112644622 missense possibly damaging 0.72
3-1:Rad18 UTSW 6 112681511 nonsense probably null
R0823:Rad18 UTSW 6 112665299 missense possibly damaging 0.80
R1220:Rad18 UTSW 6 112649664 nonsense probably null
R1351:Rad18 UTSW 6 112620902 missense possibly damaging 0.55
R1378:Rad18 UTSW 6 112681336 splice site probably benign
R1623:Rad18 UTSW 6 112628519 missense probably damaging 1.00
R1737:Rad18 UTSW 6 112681537 missense probably damaging 1.00
R2509:Rad18 UTSW 6 112675922 missense possibly damaging 0.93
R2893:Rad18 UTSW 6 112675773 nonsense probably null
R2894:Rad18 UTSW 6 112675773 nonsense probably null
R3017:Rad18 UTSW 6 112681366 missense possibly damaging 0.95
R3123:Rad18 UTSW 6 112681346 missense probably benign 0.41
R3755:Rad18 UTSW 6 112693471 missense probably damaging 1.00
R5285:Rad18 UTSW 6 112686765 missense probably benign 0.45
R5566:Rad18 UTSW 6 112681346 missense probably benign 0.41
R5958:Rad18 UTSW 6 112696642 unclassified probably benign
R6744:Rad18 UTSW 6 112675784 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTTGAAAGTGCACGGCAAAG -3'
(R):5'- ACCTGTCCACAAAGCAAGTAGG -3'

Sequencing Primer
(F):5'- TGCACGGCAAAGGAACG -3'
(R):5'- GGGAAGCTTTTCTCAGTCATGATCC -3'
Posted On2015-07-06