Incidental Mutation 'R4392:Brsk1'
ID326407
Institutional Source Beutler Lab
Gene Symbol Brsk1
Ensembl Gene ENSMUSG00000035390
Gene NameBR serine/threonine kinase 1
SynonymsSAD-B, LOC381979
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4392 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location4690604-4715997 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 4698750 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 170 (I170N)
Ref Sequence ENSEMBL: ENSMUSP00000145970 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048248] [ENSMUST00000120836] [ENSMUST00000205666] [ENSMUST00000206024]
Predicted Effect probably damaging
Transcript: ENSMUST00000048248
AA Change: I170N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000039517
Gene: ENSMUSG00000035390
AA Change: I170N

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
low complexity region 13 30 N/A INTRINSIC
S_TKc 34 285 6.75e-103 SMART
low complexity region 330 344 N/A INTRINSIC
low complexity region 430 457 N/A INTRINSIC
low complexity region 492 517 N/A INTRINSIC
low complexity region 523 552 N/A INTRINSIC
low complexity region 668 686 N/A INTRINSIC
low complexity region 746 764 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120836
AA Change: I95N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113448
Gene: ENSMUSG00000035390
AA Change: I95N

DomainStartEndE-ValueType
S_TKc 1 210 1.19e-71 SMART
low complexity region 255 269 N/A INTRINSIC
low complexity region 355 382 N/A INTRINSIC
low complexity region 417 442 N/A INTRINSIC
low complexity region 448 477 N/A INTRINSIC
low complexity region 593 611 N/A INTRINSIC
low complexity region 671 689 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000205666
AA Change: I134N

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
Predicted Effect probably damaging
Transcript: ENSMUST00000206024
AA Change: I170N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.358 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype PHENOTYPE: Homozygous mutant mice are healthy and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Brsk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01704:Brsk1 APN 7 4704261 missense probably benign 0.03
IGL01733:Brsk1 APN 7 4706072 missense probably damaging 1.00
IGL03019:Brsk1 APN 7 4710497 intron probably benign
IGL03088:Brsk1 APN 7 4710454 intron probably benign
R0612:Brsk1 UTSW 7 4707426 missense possibly damaging 0.96
R0891:Brsk1 UTSW 7 4704227 missense possibly damaging 0.95
R1455:Brsk1 UTSW 7 4704251 missense probably damaging 1.00
R1728:Brsk1 UTSW 7 4704219 missense probably damaging 1.00
R2884:Brsk1 UTSW 7 4691123 unclassified probably benign
R2939:Brsk1 UTSW 7 4708140 missense possibly damaging 0.53
R4661:Brsk1 UTSW 7 4707299 missense possibly damaging 0.73
R4662:Brsk1 UTSW 7 4707299 missense possibly damaging 0.73
R4756:Brsk1 UTSW 7 4708867 missense possibly damaging 0.72
R4788:Brsk1 UTSW 7 4698955 splice site probably null
R5026:Brsk1 UTSW 7 4704266 missense probably damaging 1.00
R5248:Brsk1 UTSW 7 4708866 missense possibly damaging 0.53
R5267:Brsk1 UTSW 7 4704709 missense probably damaging 1.00
R5419:Brsk1 UTSW 7 4709004 missense possibly damaging 0.53
R5430:Brsk1 UTSW 7 4710436 missense probably benign 0.00
R5625:Brsk1 UTSW 7 4706400 missense probably damaging 1.00
R5659:Brsk1 UTSW 7 4715372 missense possibly damaging 0.93
R6700:Brsk1 UTSW 7 4692701 missense probably damaging 0.99
R6866:Brsk1 UTSW 7 4706407 missense probably damaging 0.98
Z1088:Brsk1 UTSW 7 4707372 missense possibly damaging 0.96
Predicted Primers PCR Primer
(F):5'- CAGGCTTCCCATACATGTGCAC -3'
(R):5'- TCTGGACATGCGTAATGGGG -3'

Sequencing Primer
(F):5'- CCTCGACTACATAATTGCTGTGAGG -3'
(R):5'- GGGACCTGGAGAAAGAGAAAGATAG -3'
Posted On2015-07-06