Incidental Mutation 'R4392:Homer3'
ID326415
Institutional Source Beutler Lab
Gene Symbol Homer3
Ensembl Gene ENSMUSG00000003573
Gene Namehomer scaffolding protein 3
Synonyms
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.149) question?
Stock #R4392 (G1)
Quality Score149
Status Validated
Chromosome8
Chromosomal Location70282827-70294361 bp(+) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) G to A at 70290143 bp
ZygosityHeterozygous
Amino Acid Change
Gene Model predicted gene model for transcript(s): [ENSMUST00000003669] [ENSMUST00000008004] [ENSMUST00000087467] [ENSMUST00000110124] [ENSMUST00000140212]
Predicted Effect possibly damaging
Transcript: ENSMUST00000003669
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000003669
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000008004
SMART Domains Protein: ENSMUSP00000008004
Gene: ENSMUSG00000057788

DomainStartEndE-ValueType
DEXDc 21 222 1.85e-57 SMART
HELICc 262 343 2.41e-29 SMART
low complexity region 369 383 N/A INTRINSIC
low complexity region 461 470 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000087467
SMART Domains Protein: ENSMUSP00000084735
Gene: ENSMUSG00000003573

DomainStartEndE-ValueType
Pfam:WH1 1 107 4.2e-36 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110124
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105751
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 285 342 2e-10 PDB
low complexity region 343 358 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127094
Predicted Effect probably null
Transcript: ENSMUST00000135368
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135692
Predicted Effect possibly damaging
Transcript: ENSMUST00000140212
AA Change: R168Q

PolyPhen 2 Score 0.919 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000117033
Gene: ENSMUSG00000003573
AA Change: R168Q

DomainStartEndE-ValueType
WH1 4 110 4.92e-37 SMART
low complexity region 198 210 N/A INTRINSIC
PDB:3CVF|D 282 339 2e-10 PDB
low complexity region 340 355 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143528
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144890
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155711
Meta Mutation Damage Score 0.6232 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the HOMER family of postsynaptic density scaffolding proteins that share a similar domain structure consisting of an N-terminal Enabled/vasodilator-stimulated phosphoprotein homology 1 domain which mediates protein-protein interactions, and a carboxy-terminal coiled-coil domain and two leucine zipper motifs that are involved in self-oligomerization. The encoded protein binds numerous other proteins including group I metabotropic glutamate receptors, inositol 1,4,5-trisphosphate receptors and amyloid precursor proteins and has been implicated in diverse biological functions such as neuronal signaling, T-cell activation and trafficking of amyloid beta peptides. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Mar 2009]
PHENOTYPE: Homozygous mutants exhibit normal sensitivity to cocaine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Homer3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01966:Homer3 APN 8 70290157 missense probably damaging 0.96
IGL02493:Homer3 APN 8 70290071 missense probably benign 0.00
IGL03134:Homer3 UTSW 8 70286335 missense probably benign 0.00
R2436:Homer3 UTSW 8 70293056 missense possibly damaging 0.91
R3508:Homer3 UTSW 8 70291355 missense probably benign 0.06
R4391:Homer3 UTSW 8 70290143 unclassified probably null
R4395:Homer3 UTSW 8 70290143 unclassified probably null
R4396:Homer3 UTSW 8 70290143 unclassified probably null
R4397:Homer3 UTSW 8 70290143 unclassified probably null
R4401:Homer3 UTSW 8 70290143 unclassified probably null
R4402:Homer3 UTSW 8 70290143 unclassified probably null
R4445:Homer3 UTSW 8 70290143 unclassified probably null
R4446:Homer3 UTSW 8 70290143 unclassified probably null
R4482:Homer3 UTSW 8 70290143 unclassified probably null
R4488:Homer3 UTSW 8 70290143 unclassified probably null
R4489:Homer3 UTSW 8 70290143 unclassified probably null
R4664:Homer3 UTSW 8 70290143 unclassified probably null
R4666:Homer3 UTSW 8 70290143 unclassified probably null
R4751:Homer3 UTSW 8 70285434 missense probably damaging 1.00
R5071:Homer3 UTSW 8 70291355 missense probably benign
R5828:Homer3 UTSW 8 70286306 missense probably benign 0.02
R6052:Homer3 UTSW 8 70291426 nonsense probably null
R6211:Homer3 UTSW 8 70285524 missense probably damaging 1.00
R6234:Homer3 UTSW 8 70291165 critical splice donor site probably null
R6895:Homer3 UTSW 8 70285305 missense probably damaging 0.99
R6914:Homer3 UTSW 8 70291551 missense probably benign 0.00
R6942:Homer3 UTSW 8 70291551 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TACCCCAGTGGCTTCAATCAAC -3'
(R):5'- TAGTGACAATCAAGACCCTGAC -3'

Sequencing Primer
(F):5'- CCAGTGGCTTCAATCAACTTTAC -3'
(R):5'- AATTTCTGAGTTCGAGGCCAGC -3'
Posted On2015-07-06