Incidental Mutation 'R4392:Dopey1'
ID326419
Institutional Source Beutler Lab
Gene Symbol Dopey1
Ensembl Gene ENSMUSG00000034973
Gene Namedopey family member 1
SynonymsB130005I07Rik, D9Ertd809e
MMRRC Submission 041127-MU
Accession Numbers

Genbank: NM_177208; MGI: 1289294

Is this an essential gene? Possibly non essential (E-score: 0.332) question?
Stock #R4392 (G1)
Quality Score219
Status Validated
Chromosome9
Chromosomal Location86467154-86555923 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to C at 86503143 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140740 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034987] [ENSMUST00000185919] [ENSMUST00000188675] [ENSMUST00000190957]
Predicted Effect probably benign
Transcript: ENSMUST00000034987
SMART Domains Protein: ENSMUSP00000034987
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
Pfam:Dopey_N 11 300 1e-117 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000185840
Predicted Effect probably benign
Transcript: ENSMUST00000185919
SMART Domains Protein: ENSMUSP00000140040
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 1.9e-106 PFAM
low complexity region 629 647 N/A INTRINSIC
low complexity region 959 971 N/A INTRINSIC
low complexity region 1071 1082 N/A INTRINSIC
low complexity region 1103 1116 N/A INTRINSIC
low complexity region 1266 1279 N/A INTRINSIC
low complexity region 1294 1316 N/A INTRINSIC
low complexity region 1333 1342 N/A INTRINSIC
low complexity region 1360 1371 N/A INTRINSIC
low complexity region 1573 1587 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186290
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186418
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187607
Predicted Effect probably benign
Transcript: ENSMUST00000188675
SMART Domains Protein: ENSMUSP00000139413
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
Pfam:Dopey_N 10 306 3e-106 PFAM
low complexity region 622 640 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190834
Predicted Effect noncoding transcript
Transcript: ENSMUST00000190906
Predicted Effect probably benign
Transcript: ENSMUST00000190957
SMART Domains Protein: ENSMUSP00000140740
Gene: ENSMUSG00000034973

DomainStartEndE-ValueType
Pfam:Dopey_N 10 305 1.3e-108 PFAM
low complexity region 631 649 N/A INTRINSIC
low complexity region 961 973 N/A INTRINSIC
low complexity region 1073 1084 N/A INTRINSIC
low complexity region 1105 1118 N/A INTRINSIC
low complexity region 1268 1281 N/A INTRINSIC
low complexity region 1296 1318 N/A INTRINSIC
low complexity region 1335 1344 N/A INTRINSIC
low complexity region 1362 1373 N/A INTRINSIC
low complexity region 1575 1589 N/A INTRINSIC
low complexity region 2217 2227 N/A INTRINSIC
low complexity region 2351 2362 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Dopey1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Dopey1 APN 9 86551679 missense possibly damaging 0.57
IGL00427:Dopey1 APN 9 86521500 missense probably benign 0.09
IGL00427:Dopey1 APN 9 86521498 missense possibly damaging 0.93
IGL00427:Dopey1 APN 9 86521499 missense probably damaging 0.96
IGL00577:Dopey1 APN 9 86520946 missense probably damaging 1.00
IGL00741:Dopey1 APN 9 86522806 missense possibly damaging 0.50
IGL00959:Dopey1 APN 9 86487431 missense probably damaging 1.00
IGL01339:Dopey1 APN 9 86551677 missense possibly damaging 0.90
IGL01608:Dopey1 APN 9 86507561 missense probably benign 0.23
IGL01760:Dopey1 APN 9 86519923 missense probably benign
IGL01788:Dopey1 APN 9 86531719 missense probably benign 0.03
IGL01844:Dopey1 APN 9 86514085 missense probably damaging 1.00
IGL01923:Dopey1 APN 9 86522867 missense probably damaging 1.00
IGL02036:Dopey1 APN 9 86531765 missense probably benign 0.18
IGL02308:Dopey1 APN 9 86520088 missense probably damaging 0.98
IGL02494:Dopey1 APN 9 86526818 missense probably damaging 1.00
IGL02698:Dopey1 APN 9 86524359 splice site probably benign
IGL02731:Dopey1 APN 9 86487381 missense probably damaging 1.00
IGL02821:Dopey1 APN 9 86520156 missense probably benign
IGL02952:Dopey1 APN 9 86532922 splice site probably benign
IGL03071:Dopey1 APN 9 86489615 missense possibly damaging 0.91
IGL03271:Dopey1 APN 9 86504222 nonsense probably null
IGL03344:Dopey1 APN 9 86536144 missense probably damaging 1.00
groak UTSW 9 86521657 missense probably damaging 1.00
R0055:Dopey1 UTSW 9 86512652 missense probably benign 0.08
R0285:Dopey1 UTSW 9 86512639 missense probably damaging 1.00
R0415:Dopey1 UTSW 9 86506502 missense probably damaging 1.00
R0427:Dopey1 UTSW 9 86507532 missense probably damaging 1.00
R0514:Dopey1 UTSW 9 86520734 missense probably damaging 1.00
R0538:Dopey1 UTSW 9 86485497 missense probably damaging 1.00
R1118:Dopey1 UTSW 9 86515406 missense probably damaging 1.00
R1158:Dopey1 UTSW 9 86485556 missense probably damaging 1.00
R1272:Dopey1 UTSW 9 86521424 missense probably damaging 1.00
R1448:Dopey1 UTSW 9 86542732 splice site probably null
R1584:Dopey1 UTSW 9 86548172 nonsense probably null
R1601:Dopey1 UTSW 9 86536250 missense probably damaging 0.99
R1674:Dopey1 UTSW 9 86536160 missense probably damaging 0.98
R1706:Dopey1 UTSW 9 86554080 missense possibly damaging 0.92
R1856:Dopey1 UTSW 9 86492004 missense probably damaging 0.99
R1926:Dopey1 UTSW 9 86523019 missense probably damaging 1.00
R1929:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2029:Dopey1 UTSW 9 86521365 missense probably damaging 1.00
R2125:Dopey1 UTSW 9 86521046 missense probably damaging 1.00
R2206:Dopey1 UTSW 9 86521599 missense probably benign 0.00
R2271:Dopey1 UTSW 9 86494418 missense probably damaging 1.00
R2312:Dopey1 UTSW 9 86521442 nonsense probably null
R2379:Dopey1 UTSW 9 86521085 missense probably damaging 1.00
R2507:Dopey1 UTSW 9 86513117 missense probably damaging 1.00
R3737:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R3804:Dopey1 UTSW 9 86520995 missense probably damaging 1.00
R3916:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R3921:Dopey1 UTSW 9 86520271 missense probably benign 0.06
R4035:Dopey1 UTSW 9 86494433 missense probably damaging 1.00
R4404:Dopey1 UTSW 9 86522813 nonsense probably null
R4513:Dopey1 UTSW 9 86520559 missense probably benign 0.39
R4624:Dopey1 UTSW 9 86521525 missense probably damaging 1.00
R4659:Dopey1 UTSW 9 86502032 intron probably benign
R4910:Dopey1 UTSW 9 86492061 missense probably damaging 1.00
R4919:Dopey1 UTSW 9 86520056 missense possibly damaging 0.47
R5061:Dopey1 UTSW 9 86503108 splice site probably benign
R5079:Dopey1 UTSW 9 86487421 missense probably damaging 1.00
R5118:Dopey1 UTSW 9 86506259 missense probably damaging 1.00
R5169:Dopey1 UTSW 9 86533021 missense probably damaging 1.00
R5176:Dopey1 UTSW 9 86521815 missense probably damaging 1.00
R5190:Dopey1 UTSW 9 86487304 missense probably damaging 1.00
R5256:Dopey1 UTSW 9 86515328 missense probably damaging 1.00
R5346:Dopey1 UTSW 9 86520782 missense probably damaging 1.00
R5484:Dopey1 UTSW 9 86545288 missense probably damaging 1.00
R5501:Dopey1 UTSW 9 86507730 missense probably benign 0.04
R5554:Dopey1 UTSW 9 86521657 missense probably damaging 1.00
R5707:Dopey1 UTSW 9 86502997 missense possibly damaging 0.95
R5826:Dopey1 UTSW 9 86507570 missense possibly damaging 0.94
R5921:Dopey1 UTSW 9 86501922 missense probably damaging 1.00
R5934:Dopey1 UTSW 9 86542442 nonsense probably null
R5936:Dopey1 UTSW 9 86536512 nonsense probably null
R6046:Dopey1 UTSW 9 86515343 missense probably damaging 1.00
R6053:Dopey1 UTSW 9 86515294 missense possibly damaging 0.95
R6072:Dopey1 UTSW 9 86507697 missense probably benign 0.00
R6104:Dopey1 UTSW 9 86520807 missense possibly damaging 0.86
R6125:Dopey1 UTSW 9 86521133 missense probably damaging 1.00
R6299:Dopey1 UTSW 9 86504212 missense probably damaging 1.00
R6930:Dopey1 UTSW 9 86531772 critical splice donor site probably null
R6949:Dopey1 UTSW 9 86500860 missense probably damaging 1.00
R6979:Dopey1 UTSW 9 86521642 missense possibly damaging 0.77
X0019:Dopey1 UTSW 9 86506227 missense probably damaging 1.00
X0019:Dopey1 UTSW 9 86531750 missense probably damaging 0.98
ZE80:Dopey1 UTSW 9 86500842 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGTTTCAGATGGGTACAG -3'
(R):5'- GACTTTGTTGCCTAACACAGTG -3'

Sequencing Primer
(F):5'- CGTTTCAGATGGGTACAGTTAAAAAC -3'
(R):5'- TGCCTAACACAGTGTAAAACATAGG -3'
Posted On2015-07-06