Incidental Mutation 'R4392:Slc10a1'
ID326428
Institutional Source Beutler Lab
Gene Symbol Slc10a1
Ensembl Gene ENSMUSG00000021135
Gene Namesolute carrier family 10 (sodium/bile acid cotransporter family), member 1
SynonymsNtcp, sodium bile acid cotransporting polypeptide
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4392 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location80953183-80968705 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 80967804 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Aspartic acid at position 47 (E47D)
Ref Sequence ENSEMBL: ENSMUSP00000151510 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095572] [ENSMUST00000218162] [ENSMUST00000218342] [ENSMUST00000220266]
Predicted Effect possibly damaging
Transcript: ENSMUST00000095572
AA Change: E47D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000093229
Gene: ENSMUSG00000021135
AA Change: E47D

DomainStartEndE-ValueType
Pfam:SBF 32 217 3.3e-47 PFAM
transmembrane domain 222 244 N/A INTRINSIC
transmembrane domain 282 304 N/A INTRINSIC
low complexity region 323 333 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000218162
AA Change: E47D

PolyPhen 2 Score 0.952 (Sensitivity: 0.79; Specificity: 0.95)
Predicted Effect possibly damaging
Transcript: ENSMUST00000218342
AA Change: E47D

PolyPhen 2 Score 0.733 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect probably damaging
Transcript: ENSMUST00000220266
AA Change: E47D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Meta Mutation Damage Score 0.136 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the sodium/bile acid cotransporter family, which are integral membrane glycoproteins that participate in the enterohepatic circulation of bile acids. Two homologous transporters are involved in the reabsorption of bile acids; the ileal sodium/bile acid cotransporter with an apical cell localization that absorbs bile acids from the intestinal lumen, bile duct and kidney, and the liver-specific sodium/bile acid cotransporter, represented by this protein, that is found in the basolateral membranes of hepatocytes. Bile acids are the catabolic product of cholesterol metabolism, hence this protein is important for cholesterol homeostasis. [provided by RefSeq, Oct 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Slc10a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01870:Slc10a1 APN 12 80960528 missense probably benign 0.00
IGL02065:Slc10a1 APN 12 80960474 missense possibly damaging 0.94
R0212:Slc10a1 UTSW 12 80967712 missense possibly damaging 0.62
R1170:Slc10a1 UTSW 12 80956028 missense probably damaging 1.00
R1261:Slc10a1 UTSW 12 80967830 missense probably damaging 1.00
R1832:Slc10a1 UTSW 12 80953672 missense probably benign 0.23
R2010:Slc10a1 UTSW 12 80960447 missense probably benign 0.00
R2094:Slc10a1 UTSW 12 80956048 missense possibly damaging 0.88
R2206:Slc10a1 UTSW 12 80967628 missense probably damaging 0.99
R3905:Slc10a1 UTSW 12 80967667 missense probably damaging 0.99
R4413:Slc10a1 UTSW 12 80958132 missense probably benign 0.01
R5173:Slc10a1 UTSW 12 80956028 missense probably damaging 1.00
R5344:Slc10a1 UTSW 12 80953766 missense possibly damaging 0.56
Predicted Primers PCR Primer
(F):5'- TTCATGGCCAGGGTGAAGAG -3'
(R):5'- TTGTCCAGAAACTCTGTCCTG -3'

Sequencing Primer
(F):5'- AAGAGGTTAGACAGGTTCCCCC -3'
(R):5'- TGTCCAGAAACTCTGTCCTGAAAGAG -3'
Posted On2015-07-06