Incidental Mutation 'R4392:Mmrn2'
ID326433
Institutional Source Beutler Lab
Gene Symbol Mmrn2
Ensembl Gene ENSMUSG00000041445
Gene Namemultimerin 2
SynonymsEmilin3, EndoGlyx-1, ENDOGLYX1
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.052) question?
Stock #R4392 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location34375465-34404287 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 34397616 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Histidine at position 184 (L184H)
Ref Sequence ENSEMBL: ENSMUSP00000107539 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000111908]
Predicted Effect probably damaging
Transcript: ENSMUST00000111908
AA Change: L184H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107539
Gene: ENSMUSG00000041445
AA Change: L184H

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:EMI 55 127 1.1e-15 PFAM
low complexity region 174 186 N/A INTRINSIC
low complexity region 356 362 N/A INTRINSIC
coiled coil region 387 480 N/A INTRINSIC
coiled coil region 533 583 N/A INTRINSIC
coiled coil region 688 715 N/A INTRINSIC
Pfam:C1q 821 940 1.5e-27 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000227130
AA Change: L105H
Meta Mutation Damage Score 0.124 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein belonging to the member of elastin microfibril interface-located (EMILIN) protein family. This family member is an extracellular matrix glycoprotein that can interfere with tumor angiogenesis and growth. It serves as a transforming growth factor beta antagonist and can interfere with the VEGF-A/VEGFR2 pathway. A related pseudogene has been identified on chromosome 6. [provided by RefSeq, Aug 2012]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dip2b T C 15: 100,162,036 L223P probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 probably benign Het
Esp34 T C 17: 38,559,491 V24A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F467S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mroh2a C T 1: 88,259,589 R133C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y457H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F29C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Mmrn2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01523:Mmrn2 APN 14 34403217 missense probably damaging 1.00
IGL02529:Mmrn2 APN 14 34398613 missense possibly damaging 0.74
IGL02590:Mmrn2 APN 14 34399267 nonsense probably null
P0037:Mmrn2 UTSW 14 34403065 missense probably damaging 1.00
R0323:Mmrn2 UTSW 14 34398034 missense probably damaging 0.97
R0499:Mmrn2 UTSW 14 34397956 missense probably damaging 1.00
R1073:Mmrn2 UTSW 14 34396294 critical splice donor site probably null
R1422:Mmrn2 UTSW 14 34396239 missense probably damaging 1.00
R1455:Mmrn2 UTSW 14 34399132 missense probably benign 0.00
R1584:Mmrn2 UTSW 14 34375685 missense probably benign 0.19
R1702:Mmrn2 UTSW 14 34397914 missense probably benign 0.34
R1919:Mmrn2 UTSW 14 34397643 missense probably benign 0.10
R1961:Mmrn2 UTSW 14 34398475 unclassified probably null
R2267:Mmrn2 UTSW 14 34399492 missense probably benign 0.41
R2268:Mmrn2 UTSW 14 34399492 missense probably benign 0.41
R2516:Mmrn2 UTSW 14 34398802 missense probably benign 0.12
R2571:Mmrn2 UTSW 14 34402939 missense probably damaging 0.99
R2696:Mmrn2 UTSW 14 34398415 missense probably damaging 1.00
R2892:Mmrn2 UTSW 14 34396630 missense probably benign 0.01
R2919:Mmrn2 UTSW 14 34402922 missense possibly damaging 0.72
R3611:Mmrn2 UTSW 14 34398675 missense probably benign 0.00
R3898:Mmrn2 UTSW 14 34399560 unclassified probably null
R3899:Mmrn2 UTSW 14 34399560 unclassified probably null
R3900:Mmrn2 UTSW 14 34399560 unclassified probably null
R4363:Mmrn2 UTSW 14 34397977 missense probably damaging 0.99
R4510:Mmrn2 UTSW 14 34403059 missense possibly damaging 0.67
R4511:Mmrn2 UTSW 14 34403059 missense possibly damaging 0.67
R4993:Mmrn2 UTSW 14 34396398 missense probably damaging 1.00
R5026:Mmrn2 UTSW 14 34399201 missense probably benign 0.07
R5263:Mmrn2 UTSW 14 34399584 missense probably benign
R5478:Mmrn2 UTSW 14 34396582 missense probably benign 0.11
R5606:Mmrn2 UTSW 14 34397624 missense probably damaging 1.00
R6059:Mmrn2 UTSW 14 34397591 nonsense probably null
R6279:Mmrn2 UTSW 14 34397657 missense probably benign
R6300:Mmrn2 UTSW 14 34397657 missense probably benign
R6938:Mmrn2 UTSW 14 34398714 missense probably benign 0.22
X0064:Mmrn2 UTSW 14 34399152 missense probably benign
Predicted Primers PCR Primer
(F):5'- TACATTCCAGCTTAGGAGGGG -3'
(R):5'- GCCAGGAAACTCTGCAACAG -3'

Sequencing Primer
(F):5'- TTAGGAGGGGCCAACGTACTTC -3'
(R):5'- GTTTCAGAAAAGCCTGCTGC -3'
Posted On2015-07-06