Incidental Mutation 'R4392:Dip2b'
ID326437
Institutional Source Beutler Lab
Gene Symbol Dip2b
Ensembl Gene ENSMUSG00000023026
Gene Namedisco interacting protein 2 homolog B
Synonyms
MMRRC Submission 041127-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.484) question?
Stock #R4392 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location100038664-100219473 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 100162036 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 223 (L223P)
Ref Sequence ENSEMBL: ENSMUSP00000104599 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023768] [ENSMUST00000100203] [ENSMUST00000108971]
Predicted Effect probably damaging
Transcript: ENSMUST00000023768
AA Change: L223P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000023768
Gene: ENSMUSG00000023026
AA Change: L223P

DomainStartEndE-ValueType
Pfam:AMP-binding 109 584 9.5e-26 PFAM
Pfam:AMP-binding 760 1235 1.2e-52 PFAM
low complexity region 1299 1311 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000100203
AA Change: L457P

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000097777
Gene: ENSMUSG00000023026
AA Change: L457P

DomainStartEndE-ValueType
DMAP_binding 12 130 1e-42 SMART
low complexity region 152 168 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
Pfam:AMP-binding 341 817 2e-26 PFAM
Pfam:AMP-binding 993 1468 1.8e-64 PFAM
low complexity region 1532 1544 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000108971
AA Change: L223P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000104599
Gene: ENSMUSG00000023026
AA Change: L223P

DomainStartEndE-ValueType
Pfam:AMP-binding 108 583 9.5e-26 PFAM
Pfam:AMP-binding 759 1234 1.2e-52 PFAM
low complexity region 1298 1310 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230733
Meta Mutation Damage Score 0.382 question?
Coding Region Coverage
  • 1x: 99.5%
  • 3x: 98.5%
  • 10x: 96.1%
  • 20x: 90.5%
Validation Efficiency 95% (69/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the disco-interacting protein homolog 2 protein family. The encoded protein contains a binding site for the transcriptional regulator DNA methyltransferase 1 associated protein 1 as well as AMP-binding sites. The presence of these sites suggests that the encoded protein may participate in DNA methylation. This gene is located near a folate-sensitive fragile site, and CGG-repeat expansion in the promoter of this gene which affects transcription has been detected in individuals containing this fragile site on chromosome 12. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 60 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931414P19Rik C T 14: 54,584,978 probably null Het
Abca13 A C 11: 9,309,034 K2920T possibly damaging Het
Amy2b T G 3: 113,149,408 noncoding transcript Het
Anapc1 T C 2: 128,676,249 probably null Het
Bmp7 T G 2: 172,916,542 D178A probably benign Het
Brsk1 T A 7: 4,698,750 I170N probably damaging Het
Bub3 C T 7: 131,566,335 A187V probably benign Het
Cacna2d2 A G 9: 107,400,280 H71R possibly damaging Het
Cdrt4 A T 11: 62,951,353 K20N probably benign Het
Clec12a A T 6: 129,353,464 probably benign Het
Col12a1 T A 9: 79,662,488 Y1600F probably damaging Het
Cyp2a12 T A 7: 27,029,275 I57N probably damaging Het
Dnah5 G A 15: 28,289,229 R1188H probably benign Het
Dopey1 T C 9: 86,503,143 probably benign Het
Efcab5 T A 11: 77,090,458 N1354I probably damaging Het
Eif4b T A 15: 102,086,641 probably null Het
Elmsan1 A T 12: 84,173,111 D356E probably benign Het
Erlec1 A G 11: 30,943,697 probably null Het
Esp24 T C 17: 39,040,077 L56P probably benign Het
Esp34 T C 17: 38,559,491 V92A possibly damaging Het
Fbxw15 T A 9: 109,568,232 probably benign Het
Foxc2 T C 8: 121,117,452 S280P probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Grk3 A G 5: 112,920,136 F509S probably damaging Het
Grwd1 C T 7: 45,827,780 G228S probably damaging Het
Gtf2i T C 5: 134,260,629 E399G probably damaging Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Homer3 G A 8: 70,290,143 R168Q probably null Het
Lhx4 A G 1: 155,710,134 Y83H probably damaging Het
Mdga1 T C 17: 29,850,656 T413A probably damaging Het
Mmrn2 T A 14: 34,397,616 L184H probably damaging Het
Mroh2a C T 1: 88,259,589 R1638C probably damaging Het
Myh13 A C 11: 67,344,881 probably null Het
Nkain3 C A 4: 20,282,985 R116L possibly damaging Het
Nxph2 A C 2: 23,400,272 Q212P probably damaging Het
Olfr268-ps1 T C 2: 111,844,345 noncoding transcript Het
Olfr726 A G 14: 50,084,603 F26S probably benign Het
Otog T C 7: 46,285,124 Y1369H probably damaging Het
Prl A G 13: 27,064,351 I131V possibly damaging Het
Ptprg A T 14: 12,142,467 I373F possibly damaging Het
Rad18 A T 6: 112,693,529 C25S probably damaging Het
Rgs12 A G 5: 35,032,311 T678A probably damaging Het
Scaper T A 9: 55,858,115 E557V probably damaging Het
Scube3 C T 17: 28,164,788 P511L probably null Het
Sgpl1 A G 10: 61,104,452 probably benign Het
Slc10a1 C A 12: 80,967,804 E47D probably damaging Het
Sptbn4 T C 7: 27,418,471 N369S probably damaging Het
Sstr5 T C 17: 25,491,224 T344A probably benign Het
Tgm4 C T 9: 123,066,752 T631I probably benign Het
Tmprss15 A G 16: 79,024,438 Y472H probably damaging Het
Trpm7 A T 2: 126,795,509 probably null Het
Trpm7 A T 2: 126,848,538 W207R probably damaging Het
Ttc26 A G 6: 38,381,557 probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P317L probably damaging Het
Usp2 A T 9: 44,091,259 H384L probably damaging Het
Vmn2r27 C T 6: 124,230,176 V169I probably benign Het
Vopp1 A C 6: 57,762,476 F96C probably damaging Het
Wrn T C 8: 33,251,832 D953G probably damaging Het
Zfp759 T A 13: 67,139,643 C419* probably null Het
Other mutations in Dip2b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Dip2b APN 15 100174501 missense probably damaging 1.00
IGL01716:Dip2b APN 15 100209636 missense probably benign 0.00
IGL01893:Dip2b APN 15 100171220 unclassified probably benign
IGL01915:Dip2b APN 15 100178511 missense probably damaging 1.00
IGL02125:Dip2b APN 15 100186250 missense possibly damaging 0.60
IGL02200:Dip2b APN 15 100151202 missense possibly damaging 0.93
IGL02506:Dip2b APN 15 100157281 missense probably damaging 1.00
IGL02571:Dip2b APN 15 100157885 missense possibly damaging 0.93
IGL02706:Dip2b APN 15 100215311 missense probably damaging 0.98
IGL02983:Dip2b APN 15 100132022 missense possibly damaging 0.81
IGL03120:Dip2b APN 15 100203127 unclassified probably benign
IGL03181:Dip2b APN 15 100215207 missense probably damaging 0.98
IGL03229:Dip2b APN 15 100207838 unclassified probably benign
IGL03399:Dip2b APN 15 100175327 missense possibly damaging 0.63
PIT4131001:Dip2b UTSW 15 100202352 missense probably damaging 1.00
R0009:Dip2b UTSW 15 100169312 missense probably damaging 1.00
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0058:Dip2b UTSW 15 100215240 missense probably benign 0.03
R0092:Dip2b UTSW 15 100202265 missense probably damaging 1.00
R0201:Dip2b UTSW 15 100186147 missense probably damaging 0.98
R0359:Dip2b UTSW 15 100211993 missense probably damaging 0.98
R0390:Dip2b UTSW 15 100193913 missense probably damaging 0.99
R0564:Dip2b UTSW 15 100162719 nonsense probably null
R0730:Dip2b UTSW 15 100171651 missense probably damaging 1.00
R1144:Dip2b UTSW 15 100154250 missense probably benign 0.11
R1200:Dip2b UTSW 15 100209745 missense probably benign 0.00
R1506:Dip2b UTSW 15 100183113 missense probably damaging 1.00
R1750:Dip2b UTSW 15 100178466 missense probably benign
R1760:Dip2b UTSW 15 100212029 missense probably damaging 1.00
R1773:Dip2b UTSW 15 100193961 missense probably benign 0.00
R1812:Dip2b UTSW 15 100198938 splice site probably null
R2264:Dip2b UTSW 15 100203216 missense probably benign 0.05
R3105:Dip2b UTSW 15 100142137 nonsense probably null
R4029:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4030:Dip2b UTSW 15 100186172 missense probably damaging 1.00
R4296:Dip2b UTSW 15 100181336 missense probably benign
R4480:Dip2b UTSW 15 100186301 missense probably damaging 0.99
R4564:Dip2b UTSW 15 100157258 nonsense probably null
R4605:Dip2b UTSW 15 100209636 missense probably benign 0.00
R4606:Dip2b UTSW 15 100215329 missense possibly damaging 0.91
R4634:Dip2b UTSW 15 100160491 missense probably damaging 1.00
R4667:Dip2b UTSW 15 100151360 missense probably benign 0.01
R4739:Dip2b UTSW 15 100207777 missense probably damaging 0.98
R4826:Dip2b UTSW 15 100169281 missense probably damaging 0.99
R4870:Dip2b UTSW 15 100195784 splice site probably null
R4877:Dip2b UTSW 15 100160529 missense possibly damaging 0.49
R4932:Dip2b UTSW 15 100171722 missense probably damaging 1.00
R5009:Dip2b UTSW 15 100195784 splice site probably null
R5169:Dip2b UTSW 15 100205113 missense probably damaging 1.00
R5216:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5218:Dip2b UTSW 15 100154296 missense probably benign 0.00
R5274:Dip2b UTSW 15 100212104 missense possibly damaging 0.54
R5370:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5420:Dip2b UTSW 15 100205173 intron probably benign
R5447:Dip2b UTSW 15 100211986 missense probably damaging 1.00
R5670:Dip2b UTSW 15 100190104 missense possibly damaging 0.80
R5768:Dip2b UTSW 15 100157945 missense probably benign 0.32
R5908:Dip2b UTSW 15 100151184 missense possibly damaging 0.93
R5957:Dip2b UTSW 15 100209694 missense probably benign 0.03
R5987:Dip2b UTSW 15 100190079 missense probably damaging 1.00
R6260:Dip2b UTSW 15 100162702 missense probably benign 0.05
R6325:Dip2b UTSW 15 100154282 missense probably benign 0.00
R6367:Dip2b UTSW 15 100115914 missense possibly damaging 0.50
R6391:Dip2b UTSW 15 100151276 missense probably damaging 1.00
R6422:Dip2b UTSW 15 100199011 missense probably damaging 0.98
R6818:Dip2b UTSW 15 100193954 missense probably benign 0.09
R6922:Dip2b UTSW 15 100193843 missense probably benign 0.25
X0064:Dip2b UTSW 15 100115850 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTGAGCTGTGCCATTTG -3'
(R):5'- ATGTACAGAGTCCCAGCTCC -3'

Sequencing Primer
(F):5'- CCATTTGGCACAGTGGGTAG -3'
(R):5'- GGGATAACCACGGTAGCCATCTC -3'
Posted On2015-07-06