Incidental Mutation 'R4393:Vmn2r79'
ID326471
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Namevomeronasal 2, receptor 79
SynonymsEG621430
MMRRC Submission 041128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4393 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86996465-87037968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87001891 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 166 (H166R)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164462
AA Change: H166R

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: H166R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 95% (71/75)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433N12Rik C A 9: 3,134,944 noncoding transcript Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Adgrl1 T C 8: 83,938,593 V1353A probably benign Het
Casc1 T C 6: 145,194,578 T166A possibly damaging Het
Cep68 A T 11: 20,238,544 N620K probably benign Het
Clcnkb A G 4: 141,412,236 S152P probably benign Het
Crybg3 A G 16: 59,560,095 probably benign Het
Cyp26c1 G A 19: 37,686,657 R142H probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg5 T A 14: 24,177,989 probably null Het
Ebf3 C T 7: 137,225,157 R342H probably damaging Het
Ece2 T C 16: 20,632,848 V380A probably damaging Het
Epb41l4a C T 18: 33,891,420 probably null Het
Erbb3 G T 10: 128,572,770 Q815K probably damaging Het
Ercc3 T A 18: 32,265,621 M651K probably benign Het
Fam3b C A 16: 97,481,786 probably null Het
Foxp2 A C 6: 15,377,690 probably benign Het
Gdf10 T C 14: 33,932,738 Y401H probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Gm6408 A T 5: 146,482,337 D54V probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Hcn4 A G 9: 58,844,300 E403G unknown Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hjurp A G 1: 88,266,561 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Il11ra1 T C 4: 41,768,577 probably null Het
Immt T A 6: 71,872,800 S435T probably benign Het
Kcnip2 A G 19: 45,812,230 L19P probably benign Het
Kctd2 T C 11: 115,429,500 probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mdn1 C T 4: 32,754,482 T4666M possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Msl2 A G 9: 101,101,477 E350G probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo3a A T 2: 22,577,854 K373N probably damaging Het
Nr5a1 T C 2: 38,694,219 E396G probably damaging Het
Ogdh G A 11: 6,316,772 G141D probably damaging Het
Olfr1133 A T 2: 87,645,912 C70* probably null Het
Olfr1491 T C 19: 13,705,190 I121T possibly damaging Het
Olfr92 T C 17: 37,114,084 probably benign Het
Orc2 C A 1: 58,467,650 probably null Het
P4ha3 C T 7: 100,305,607 P291S probably benign Het
Pign T C 1: 105,522,026 K925R probably benign Het
Plekhm1 A G 11: 103,376,965 S727P possibly damaging Het
Prr36 G T 8: 4,214,901 probably benign Het
Prrt3 A G 6: 113,494,946 L755P probably benign Het
Secisbp2 A G 13: 51,654,466 H89R probably damaging Het
Sgms2 A T 3: 131,341,817 probably null Het
Slc35d3 T C 10: 19,849,606 probably null Het
Slu7 T A 11: 43,439,269 N174K possibly damaging Het
Teddm1a G T 1: 153,892,446 D219Y probably damaging Het
Tgtp1 C A 11: 48,987,623 G85V probably damaging Het
Tmem51 T C 4: 142,031,931 T169A probably benign Het
Tmem69 C T 4: 116,554,767 probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vwa3b T C 1: 37,045,178 V144A probably damaging Het
Zdhhc21 A G 4: 82,847,654 C15R possibly damaging Het
Zfp142 T C 1: 74,572,060 T756A probably benign Het
Zfp606 C T 7: 12,492,849 S241F probably damaging Het
Zfp804a A T 2: 82,256,921 T365S probably benign Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87037273 missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86996648 missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87002158 missense probably benign
IGL01834:Vmn2r79 APN 7 87037146 missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87037277 missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87037363 missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87037082 missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87002536 missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87004158 missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 87003591 missense probably benign 0.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87003386 missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87002079 missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87002403 missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87003473 missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87004099 missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87037794 missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87037444 missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87004039 critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87037834 missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87002631 missense probably benign
R1781:Vmn2r79 UTSW 7 87002347 missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87001413 missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87037872 missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87004081 missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86996631 missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87002037 missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87002194 missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87003593 missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87002416 missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4394:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 87037960 missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 87001467 missense probably benign
R5016:Vmn2r79 UTSW 7 87037340 missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87002215 missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 87001969 missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87002570 missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87037157 missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87037768 missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 87001314 missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 87002290 missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87002044 missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87003533 missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 87004162 missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 87037372 missense probably benign
R6965:Vmn2r79 UTSW 7 87001892 missense probably benign 0.10
R7130:Vmn2r79 UTSW 7 87002266 missense not run
U15987:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87004062 missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87002341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTTTATGACAAATGGGCAGGAG -3'
(R):5'- TTCCTGCTCTCAATTCAGAAAGG -3'

Sequencing Primer
(F):5'- CTGTACTTGTACAGCAATTCACAAG -3'
(R):5'- CTGCTCTCAATTCAGAAAGGAACTG -3'
Posted On2015-07-06