Incidental Mutation 'R4393:Crybg3'
ID326493
Institutional Source Beutler Lab
Gene Symbol Crybg3
Ensembl Gene ENSMUSG00000022723
Gene Namebeta-gamma crystallin domain containing 3
Synonyms
MMRRC Submission 041128-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.070) question?
Stock #R4393 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location59490775-59600979 bp(-) (GRCm38)
Type of Mutationunclassified
DNA Base Change (assembly) A to G at 59560095 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000037682 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044604] [ENSMUST00000172910]
Predicted Effect probably benign
Transcript: ENSMUST00000044604
SMART Domains Protein: ENSMUSP00000037682
Gene: ENSMUSG00000022723

DomainStartEndE-ValueType
low complexity region 258 273 N/A INTRINSIC
low complexity region 282 290 N/A INTRINSIC
XTALbg 430 516 2.78e-4 SMART
Pfam:Crystall 536 599 3.3e-7 PFAM
XTALbg 614 699 1.2e-21 SMART
XTALbg 707 790 5.73e-19 SMART
XTALbg 803 881 6.87e-5 SMART
XTALbg 889 969 1.28e-7 SMART
RICIN 972 1104 8.16e-14 SMART
Predicted Effect silent
Transcript: ENSMUST00000172910
Meta Mutation Damage Score 0.066 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.7%
  • 10x: 96.5%
  • 20x: 92.4%
Validation Efficiency 95% (71/75)
Allele List at MGI
Other mutations in this stock
Total: 61 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930433N12Rik C A 9: 3,134,944 noncoding transcript Het
Adgrg4 T G X: 56,932,343 L2193V probably damaging Het
Adgrl1 T C 8: 83,938,593 V1353A probably benign Het
Casc1 T C 6: 145,194,578 T166A possibly damaging Het
Cep68 A T 11: 20,238,544 N620K probably benign Het
Clcnkb A G 4: 141,412,236 S152P probably benign Het
Cyp26c1 G A 19: 37,686,657 R142H probably damaging Het
Dab1 C T 4: 104,731,751 A524V probably benign Het
Dlg5 T A 14: 24,177,989 probably null Het
Ebf3 C T 7: 137,225,157 R342H probably damaging Het
Ece2 T C 16: 20,632,848 V380A probably damaging Het
Epb41l4a C T 18: 33,891,420 probably null Het
Erbb3 G T 10: 128,572,770 Q815K probably damaging Het
Ercc3 T A 18: 32,265,621 M651K probably benign Het
Fam3b C A 16: 97,481,786 probably null Het
Foxp2 A C 6: 15,377,690 probably benign Het
Gdf10 T C 14: 33,932,738 Y401H probably damaging Het
Gm21738 G C 14: 19,417,178 L117V probably benign Het
Gm6408 A T 5: 146,482,337 D54V probably damaging Het
Gm8909 C A 17: 36,161,969 probably benign Het
Hcn4 A G 9: 58,844,300 E403G unknown Het
Hjurp GT GTT 1: 88,266,524 probably null Het
Hjurp A G 1: 88,266,561 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Il11ra1 T C 4: 41,768,577 probably null Het
Immt T A 6: 71,872,800 S435T probably benign Het
Kcnip2 A G 19: 45,812,230 L19P probably benign Het
Kctd2 T C 11: 115,429,500 probably benign Het
Mdga1 T C 17: 29,850,517 D185G probably damaging Het
Mdn1 C T 4: 32,754,482 T4666M possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Msl2 A G 9: 101,101,477 E350G probably damaging Het
Muc4 C A 16: 32,754,529 H1468N probably benign Het
Myo3a A T 2: 22,577,854 K373N probably damaging Het
Nr5a1 T C 2: 38,694,219 E396G probably damaging Het
Ogdh G A 11: 6,316,772 G141D probably damaging Het
Olfr1133 A T 2: 87,645,912 C70* probably null Het
Olfr1491 T C 19: 13,705,190 I121T possibly damaging Het
Olfr92 T C 17: 37,114,084 probably benign Het
Orc2 C A 1: 58,467,650 probably null Het
P4ha3 C T 7: 100,305,607 P291S probably benign Het
Pign T C 1: 105,522,026 K925R probably benign Het
Plekhm1 A G 11: 103,376,965 S727P possibly damaging Het
Prr36 G T 8: 4,214,901 probably benign Het
Prrt3 A G 6: 113,494,946 L755P probably benign Het
Secisbp2 A G 13: 51,654,466 H89R probably damaging Het
Sgms2 A T 3: 131,341,817 probably null Het
Slc35d3 T C 10: 19,849,606 probably null Het
Slu7 T A 11: 43,439,269 N174K possibly damaging Het
Teddm1a G T 1: 153,892,446 D219Y probably damaging Het
Tgtp1 C A 11: 48,987,623 G85V probably damaging Het
Tmem51 T C 4: 142,031,931 T169A probably benign Het
Tmem69 C T 4: 116,554,767 probably null Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Ugt1a10 C T 1: 88,215,123 P113L probably damaging Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Vwa3b T C 1: 37,045,178 V144A probably damaging Het
Zdhhc21 A G 4: 82,847,654 C15R possibly damaging Het
Zfp142 T C 1: 74,572,060 T756A probably benign Het
Zfp606 C T 7: 12,492,849 S241F probably damaging Het
Zfp804a A T 2: 82,256,921 T365S probably benign Het
Other mutations in Crybg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Crybg3 APN 16 59530440 missense probably benign 0.15
IGL01305:Crybg3 APN 16 59529227 missense probably damaging 1.00
IGL01809:Crybg3 APN 16 59524853 critical splice donor site probably benign 0.00
IGL02247:Crybg3 APN 16 59503150 missense probably damaging 1.00
IGL02252:Crybg3 APN 16 59552524 splice site probably benign
IGL03036:Crybg3 APN 16 59555179 missense possibly damaging 0.68
IGL03202:Crybg3 APN 16 59494709 missense probably damaging 1.00
IGL03232:Crybg3 APN 16 59530368 missense probably damaging 1.00
ANU22:Crybg3 UTSW 16 59529227 missense probably damaging 1.00
R0052:Crybg3 UTSW 16 59565656 splice site probably benign
R0335:Crybg3 UTSW 16 59544140 missense probably damaging 1.00
R0691:Crybg3 UTSW 16 59565211 critical splice donor site probably null
R1511:Crybg3 UTSW 16 59554112 missense probably benign 0.01
R1579:Crybg3 UTSW 16 59530198 missense probably damaging 1.00
R1965:Crybg3 UTSW 16 59503237 missense probably damaging 1.00
R1982:Crybg3 UTSW 16 59544125 missense possibly damaging 0.85
R2225:Crybg3 UTSW 16 59554678 missense probably damaging 1.00
R4074:Crybg3 UTSW 16 59555757 unclassified probably null
R4210:Crybg3 UTSW 16 59544051 missense probably damaging 1.00
R4394:Crybg3 UTSW 16 59560095 unclassified probably benign
R4397:Crybg3 UTSW 16 59560095 unclassified probably benign
R4427:Crybg3 UTSW 16 59543199 missense probably damaging 1.00
R4578:Crybg3 UTSW 16 59530201 missense probably damaging 1.00
R4720:Crybg3 UTSW 16 59539817 missense probably damaging 1.00
R4917:Crybg3 UTSW 16 59530419 missense probably benign 0.14
R5007:Crybg3 UTSW 16 59558100 unclassified probably benign
R5020:Crybg3 UTSW 16 59554796 missense possibly damaging 0.55
R5155:Crybg3 UTSW 16 59524901 missense possibly damaging 0.91
R5306:Crybg3 UTSW 16 59559993 unclassified probably benign
R5342:Crybg3 UTSW 16 59522149 missense probably damaging 1.00
R5687:Crybg3 UTSW 16 59559166 missense probably benign 0.00
R5763:Crybg3 UTSW 16 59554610 missense possibly damaging 0.74
R5860:Crybg3 UTSW 16 59565269 missense probably damaging 1.00
R5950:Crybg3 UTSW 16 59493571 unclassified probably benign
R6007:Crybg3 UTSW 16 59554474 nonsense probably null
R6042:Crybg3 UTSW 16 59550475 missense possibly damaging 0.70
R6049:Crybg3 UTSW 16 59544054 missense probably benign 0.00
R6242:Crybg3 UTSW 16 59555690 missense probably benign
R6301:Crybg3 UTSW 16 59530338 missense probably damaging 1.00
R6408:Crybg3 UTSW 16 59495690 missense possibly damaging 0.71
R6724:Crybg3 UTSW 16 59544138 missense probably benign 0.13
R6745:Crybg3 UTSW 16 59552244 missense possibly damaging 0.93
R6777:Crybg3 UTSW 16 59558315 unclassified probably benign
R6843:Crybg3 UTSW 16 59559796 missense probably benign 0.22
R6914:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R6942:Crybg3 UTSW 16 59539820 missense possibly damaging 0.89
R7033:Crybg3 UTSW 16 59554165 missense probably damaging 1.00
R7091:Crybg3 UTSW 16 59557168 missense not run
R7133:Crybg3 UTSW 16 59536804 missense not run
Predicted Primers PCR Primer
(F):5'- AATATCCTGCAGTCCTGGGAC -3'
(R):5'- AAGGACTATACTTCACAACTGATGG -3'

Sequencing Primer
(F):5'- CCTGGGACGCTTTCCTGATG -3'
(R):5'- TAAATTATCTGGTACCCATGCTGTC -3'
Posted On2015-07-06