Incidental Mutation 'R4394:Postn'
ID326517
Institutional Source Beutler Lab
Gene Symbol Postn
Ensembl Gene ENSMUSG00000027750
Gene Nameperiostin, osteoblast specific factor
Synonymsperi, A630052E07Rik, OSF-2, Osf2, Periostin
MMRRC Submission 041683-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4394 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location54361109-54391037 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 54370955 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 295 (D295G)
Ref Sequence ENSEMBL: ENSMUSP00000112735 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073012] [ENSMUST00000081564] [ENSMUST00000107985] [ENSMUST00000117373]
Predicted Effect probably damaging
Transcript: ENSMUST00000073012
AA Change: D295G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000072773
Gene: ENSMUSG00000027750
AA Change: D295G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000081564
AA Change: D295G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000080276
Gene: ENSMUSG00000027750
AA Change: D295G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000107985
AA Change: D295G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000103619
Gene: ENSMUSG00000027750
AA Change: D295G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
low complexity region 669 680 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000117373
AA Change: D295G

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112735
Gene: ENSMUSG00000027750
AA Change: D295G

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
FAS1 135 235 7.81e-30 SMART
FAS1 272 370 2.31e-32 SMART
FAS1 406 497 2.43e-17 SMART
FAS1 534 633 2.5e-28 SMART
Meta Mutation Damage Score 0.16 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 99% (69/70)
MGI Phenotype FUNCTION: This gene encodes a secreted extracellular matrix protein that functions in tissue development and regeneration, including wound healing and ventricular remodeling following myocardial infarction. The encoded protein binds to integrins to support adhesion and migration of epithelial cells. This protein plays a role in cancer stem cell maintenance and metastasis. Mice lacking this gene exhibit cardiac valve disease, and skeletal and dental defects. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null mice display abnormalities of the enamel, periodontal ligament, ameloblasts, and incisors. For one allele changing the hardness of the food alters the severity of the abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,584 F391L probably damaging Het
AC140205.10 C A 8: 20,833,165 T192K probably benign Het
Arid4b T A 13: 14,154,972 probably null Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Brip1 A T 11: 86,074,298 N855K possibly damaging Het
Ces2f A G 8: 104,950,954 N197S probably damaging Het
Chd4 A G 6: 125,121,618 T1520A probably damaging Het
Cltc A C 11: 86,733,630 N159K probably damaging Het
Cntn1 C T 15: 92,291,764 T656I probably damaging Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dzip1l T A 9: 99,639,854 L181H probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fat3 A G 9: 15,922,792 I4168T probably benign Het
Fbxw20 T C 9: 109,232,330 D117G probably benign Het
Gm8122 A G 14: 43,234,068 L81P unknown Het
Hal T C 10: 93,496,559 probably benign Het
Hgf T A 5: 16,618,951 Y715* probably null Het
Hid1 T A 11: 115,367,642 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Jrkl G A 9: 13,245,141 Q172* probably null Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lman2l A C 1: 36,439,723 C103G probably damaging Het
Lrfn5 T C 12: 61,843,490 S522P probably damaging Het
Mark3 A T 12: 111,604,523 I86L possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mgst2 G A 3: 51,664,528 V26I probably damaging Het
Neb A T 2: 52,187,513 Y158* probably null Het
Nipbl T C 15: 8,361,861 I210V probably benign Het
Olfr1057 C T 2: 86,375,179 A78T possibly damaging Het
Olfr830 A T 9: 18,875,611 I95L probably damaging Het
Pcdhb8 C T 18: 37,356,882 P538S probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psen2 A T 1: 180,240,782 V102E probably damaging Het
Ptpn9 A T 9: 57,036,563 K126N possibly damaging Het
Ptprd A G 4: 76,128,685 I435T probably damaging Het
Rab39 T C 9: 53,686,650 K105R probably benign Het
Robo2 C A 16: 73,948,379 R840L probably benign Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Ryr1 G T 7: 29,094,242 T1267K possibly damaging Het
Sis G A 3: 72,956,149 T252I probably damaging Het
Slc41a3 A T 6: 90,635,330 S201C probably damaging Het
Slitrk1 A C 14: 108,911,303 S659A probably benign Het
Snx25 A T 8: 46,035,678 M880K probably damaging Het
Tbxas1 C T 6: 39,027,779 T320I probably benign Het
Tex44 T C 1: 86,427,767 V466A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Tpst1 T A 5: 130,102,502 M271K probably benign Het
Trank1 C T 9: 111,365,197 T763I possibly damaging Het
Trip12 A T 1: 84,725,741 H729Q probably damaging Het
Tshz3 A T 7: 36,769,605 T340S probably damaging Het
Ttc5 T C 14: 50,781,505 K52E probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Vmn2r79 A G 7: 87,001,891 H166R possibly damaging Het
Wsb2 T G 5: 117,363,578 probably benign Het
Other mutations in Postn
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00433:Postn APN 3 54373728 missense probably damaging 1.00
IGL00567:Postn APN 3 54384523 missense probably benign
IGL00742:Postn APN 3 54372894 missense possibly damaging 0.81
IGL00971:Postn APN 3 54369276 missense possibly damaging 0.88
IGL01105:Postn APN 3 54362710 missense probably damaging 1.00
IGL01460:Postn APN 3 54375158 unclassified probably benign
IGL01609:Postn APN 3 54369228 missense probably damaging 0.99
IGL01878:Postn APN 3 54383480 splice site probably null
IGL01885:Postn APN 3 54376034 unclassified probably benign
IGL02040:Postn APN 3 54362689 missense probably benign
IGL02431:Postn APN 3 54375096 missense probably damaging 0.99
IGL02578:Postn APN 3 54377204 missense possibly damaging 0.93
IGL02943:Postn APN 3 54377608 critical splice donor site probably null
IGL03307:Postn APN 3 54375127 missense probably benign 0.32
sticklike UTSW 3 54372106 missense probably damaging 1.00
R0117:Postn UTSW 3 54383481 splice site probably benign
R0270:Postn UTSW 3 54384550 missense probably damaging 0.98
R0410:Postn UTSW 3 54385277 missense possibly damaging 0.93
R0548:Postn UTSW 3 54367576 nonsense probably null
R0734:Postn UTSW 3 54362715 missense probably damaging 1.00
R1648:Postn UTSW 3 54376101 missense probably damaging 1.00
R1796:Postn UTSW 3 54373756 missense probably damaging 1.00
R1823:Postn UTSW 3 54385287 critical splice donor site probably null
R1938:Postn UTSW 3 54377612 splice site probably null
R2311:Postn UTSW 3 54385223 missense probably damaging 0.98
R2566:Postn UTSW 3 54376953 missense probably damaging 0.97
R2938:Postn UTSW 3 54370310 missense probably damaging 1.00
R4105:Postn UTSW 3 54376041 missense probably damaging 1.00
R4620:Postn UTSW 3 54376993 missense probably damaging 1.00
R4628:Postn UTSW 3 54372157 missense probably damaging 1.00
R4697:Postn UTSW 3 54375071 missense probably damaging 1.00
R4709:Postn UTSW 3 54384610 intron probably benign
R4952:Postn UTSW 3 54390315 utr 3 prime probably benign
R5303:Postn UTSW 3 54377597 missense probably damaging 1.00
R5704:Postn UTSW 3 54372106 missense probably damaging 1.00
R5902:Postn UTSW 3 54372089 missense probably benign 0.03
R5914:Postn UTSW 3 54373800 nonsense probably null
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6032:Postn UTSW 3 54376716 missense possibly damaging 0.53
R6101:Postn UTSW 3 54372220 splice site probably null
R6105:Postn UTSW 3 54372220 splice site probably null
R6334:Postn UTSW 3 54385282 missense probably benign
R7131:Postn UTSW 3 54362635 missense probably damaging 1.00
X0004:Postn UTSW 3 54362694 missense probably damaging 1.00
X0022:Postn UTSW 3 54370840 missense probably benign 0.03
Z1088:Postn UTSW 3 54375127 missense probably benign 0.32
Predicted Primers PCR Primer
(F):5'- ACAAGTTTCCTTTGGATTTGCC -3'
(R):5'- AATGACTGCAGCCTCACAGC -3'

Sequencing Primer
(F):5'- GGATTTGCCATGCCATCCTCTAAAAG -3'
(R):5'- AGCCTCACAGCTGTTTTTGTTAAC -3'
Posted On2015-07-06