Incidental Mutation 'R4394:Vmn2r79'
ID326531
Institutional Source Beutler Lab
Gene Symbol Vmn2r79
Ensembl Gene ENSMUSG00000090362
Gene Namevomeronasal 2, receptor 79
SynonymsEG621430
MMRRC Submission 041683-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R4394 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location86996465-87037968 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 87001891 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 166 (H166R)
Ref Sequence ENSEMBL: ENSMUSP00000132478 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164462]
Predicted Effect possibly damaging
Transcript: ENSMUST00000164462
AA Change: H166R

PolyPhen 2 Score 0.854 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000132478
Gene: ENSMUSG00000090362
AA Change: H166R

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 75 464 1.9e-31 PFAM
Pfam:NCD3G 506 559 3.1e-21 PFAM
Pfam:7tm_3 592 827 2.8e-53 PFAM
Meta Mutation Damage Score 0.0628 question?
Coding Region Coverage
  • 1x: 99.6%
  • 3x: 98.8%
  • 10x: 96.8%
  • 20x: 93.4%
Validation Efficiency 99% (69/70)
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abtb1 A G 6: 88,836,584 F391L probably damaging Het
AC140205.10 C A 8: 20,833,165 T192K probably benign Het
Arid4b T A 13: 14,154,972 probably null Het
Bahd1 G A 2: 118,922,523 R757H probably damaging Het
Brip1 A T 11: 86,074,298 N855K possibly damaging Het
Ces2f A G 8: 104,950,954 N197S probably damaging Het
Chd4 A G 6: 125,121,618 T1520A probably damaging Het
Cltc A C 11: 86,733,630 N159K probably damaging Het
Cntn1 C T 15: 92,291,764 T656I probably damaging Het
Crybg3 A G 16: 59,560,095 probably benign Het
Dzip1l T A 9: 99,639,854 L181H probably damaging Het
Fam3b C A 16: 97,481,786 probably null Het
Fat1 T A 8: 44,952,346 N711K probably damaging Het
Fat3 A G 9: 15,922,792 I4168T probably benign Het
Fbxw20 T C 9: 109,232,330 D117G probably benign Het
Gm8122 A G 14: 43,234,068 L81P unknown Het
Hal T C 10: 93,496,559 probably benign Het
Hgf T A 5: 16,618,951 Y715* probably null Het
Hid1 T A 11: 115,367,642 probably benign Het
Hyou1 T A 9: 44,381,872 V125E probably damaging Het
Jrkl G A 9: 13,245,141 Q172* probably null Het
Lamc3 A G 2: 31,931,952 E1304G probably benign Het
Lman2l A C 1: 36,439,723 C103G probably damaging Het
Lrfn5 T C 12: 61,843,490 S522P probably damaging Het
Mark3 A T 12: 111,604,523 I86L possibly damaging Het
Mfsd13a C T 19: 46,371,992 R328C probably damaging Het
Mgst2 G A 3: 51,664,528 V26I probably damaging Het
Neb A T 2: 52,187,513 Y158* probably null Het
Nipbl T C 15: 8,361,861 I210V probably benign Het
Olfr1057 C T 2: 86,375,179 A78T possibly damaging Het
Olfr830 A T 9: 18,875,611 I95L probably damaging Het
Pcdhb8 C T 18: 37,356,882 P538S probably damaging Het
Postn A G 3: 54,370,955 D295G probably damaging Het
Prss38 T C 11: 59,373,028 Y286C probably damaging Het
Psen2 A T 1: 180,240,782 V102E probably damaging Het
Ptpn9 A T 9: 57,036,563 K126N possibly damaging Het
Ptprd A G 4: 76,128,685 I435T probably damaging Het
Rab39 T C 9: 53,686,650 K105R probably benign Het
Robo2 C A 16: 73,948,379 R840L probably benign Het
Rps6ka5 T A 12: 100,581,319 I311F probably damaging Het
Ryr1 G T 7: 29,094,242 T1267K possibly damaging Het
Sis G A 3: 72,956,149 T252I probably damaging Het
Slc41a3 A T 6: 90,635,330 S201C probably damaging Het
Slitrk1 A C 14: 108,911,303 S659A probably benign Het
Snx25 A T 8: 46,035,678 M880K probably damaging Het
Tbxas1 C T 6: 39,027,779 T320I probably benign Het
Tex44 T C 1: 86,427,767 V466A probably benign Het
Tns2 C T 15: 102,108,934 R281C probably damaging Het
Tnxb C T 17: 34,678,662 Q804* probably null Het
Tpst1 T A 5: 130,102,502 M271K probably benign Het
Trank1 C T 9: 111,365,197 T763I possibly damaging Het
Trip12 A T 1: 84,725,741 H729Q probably damaging Het
Tshz3 A T 7: 36,769,605 T340S probably damaging Het
Ttc5 T C 14: 50,781,505 K52E probably benign Het
Ugt1a1 CAGAGAGAGAGAGA CAGAGAGAGAGA 1: 88,211,984 probably benign Het
Wsb2 T G 5: 117,363,578 probably benign Het
Other mutations in Vmn2r79
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01401:Vmn2r79 APN 7 87037273 missense probably benign 0.01
IGL01675:Vmn2r79 APN 7 86996648 missense probably benign 0.01
IGL01760:Vmn2r79 APN 7 87002158 missense probably benign
IGL01834:Vmn2r79 APN 7 87037146 missense probably benign 0.01
IGL01843:Vmn2r79 APN 7 87037277 missense probably damaging 1.00
IGL01914:Vmn2r79 APN 7 87037363 missense probably benign 0.14
IGL01980:Vmn2r79 APN 7 87037082 missense possibly damaging 0.49
IGL02438:Vmn2r79 APN 7 87002536 missense probably damaging 0.98
IGL02740:Vmn2r79 APN 7 87004158 missense probably benign 0.00
IGL03052:Vmn2r79 UTSW 7 87003591 missense probably benign 0.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0096:Vmn2r79 UTSW 7 87037319 missense probably damaging 1.00
R0270:Vmn2r79 UTSW 7 87003386 missense probably benign 0.00
R0336:Vmn2r79 UTSW 7 87002079 missense probably benign 0.15
R0418:Vmn2r79 UTSW 7 87002403 missense probably benign 0.18
R1070:Vmn2r79 UTSW 7 87003473 missense probably damaging 1.00
R1234:Vmn2r79 UTSW 7 87004099 missense possibly damaging 0.71
R1459:Vmn2r79 UTSW 7 87037794 missense probably benign 0.01
R1513:Vmn2r79 UTSW 7 87037444 missense probably benign 0.01
R1624:Vmn2r79 UTSW 7 87004039 critical splice acceptor site probably null
R1633:Vmn2r79 UTSW 7 87037834 missense possibly damaging 0.52
R1676:Vmn2r79 UTSW 7 87002631 missense probably benign
R1781:Vmn2r79 UTSW 7 87002347 missense probably benign 0.00
R1794:Vmn2r79 UTSW 7 87001413 missense probably benign 0.37
R1823:Vmn2r79 UTSW 7 87037872 missense probably damaging 1.00
R2013:Vmn2r79 UTSW 7 87004081 missense possibly damaging 0.50
R2018:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2019:Vmn2r79 UTSW 7 87002426 missense probably benign 0.07
R2177:Vmn2r79 UTSW 7 86996631 missense possibly damaging 0.94
R2984:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R3719:Vmn2r79 UTSW 7 87002037 missense probably benign 0.05
R3798:Vmn2r79 UTSW 7 87002194 missense possibly damaging 0.88
R3969:Vmn2r79 UTSW 7 87003593 missense probably damaging 1.00
R4182:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4183:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4245:Vmn2r79 UTSW 7 87002416 missense possibly damaging 0.73
R4301:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4391:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4393:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4396:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4397:Vmn2r79 UTSW 7 87001891 missense possibly damaging 0.85
R4592:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R4697:Vmn2r79 UTSW 7 87037960 missense probably damaging 0.98
R4897:Vmn2r79 UTSW 7 87001467 missense probably benign
R5016:Vmn2r79 UTSW 7 87037340 missense probably benign 0.00
R5058:Vmn2r79 UTSW 7 87002215 missense probably damaging 0.98
R5177:Vmn2r79 UTSW 7 87001969 missense probably damaging 0.97
R6078:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6079:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6138:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
R6257:Vmn2r79 UTSW 7 87002570 missense probably benign 0.27
R6260:Vmn2r79 UTSW 7 87037157 missense probably benign 0.00
R6307:Vmn2r79 UTSW 7 87037768 missense probably damaging 1.00
R6323:Vmn2r79 UTSW 7 87001314 missense probably benign 0.05
R6374:Vmn2r79 UTSW 7 87002290 missense probably benign 0.02
R6530:Vmn2r79 UTSW 7 87002044 missense possibly damaging 0.91
R6546:Vmn2r79 UTSW 7 87003533 missense probably benign 0.01
R6682:Vmn2r79 UTSW 7 87004162 missense possibly damaging 0.69
R6858:Vmn2r79 UTSW 7 87037372 missense probably benign
R6965:Vmn2r79 UTSW 7 87001892 missense probably benign 0.10
R7130:Vmn2r79 UTSW 7 87002266 missense not run
U15987:Vmn2r79 UTSW 7 87004111 missense possibly damaging 0.86
X0054:Vmn2r79 UTSW 7 87004062 missense probably benign 0.01
Z1088:Vmn2r79 UTSW 7 87002341 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACTTTATGACAAATGGGCAGG -3'
(R):5'- TGCTCTCAATTCAGAAAGGAACTG -3'

Sequencing Primer
(F):5'- CTGTACTTGTACAGCAATTCACAAG -3'
(R):5'- GAACTGAATTCCATGGTCATCATCTG -3'
Posted On2015-07-06