Incidental Mutation 'R4400:Fbxw28'
ID326595
Institutional Source Beutler Lab
Gene Symbol Fbxw28
Ensembl Gene ENSMUSG00000054087
Gene NameF-box and WD-40 domain protein 28
SynonymsGm9337
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.063) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location109322886-109339659 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 109328310 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 237 (F237Y)
Ref Sequence ENSEMBL: ENSMUSP00000143361 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000112039] [ENSMUST00000112040] [ENSMUST00000196351] [ENSMUST00000200156]
Predicted Effect probably damaging
Transcript: ENSMUST00000112039
AA Change: F290Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107670
Gene: ENSMUSG00000054087
AA Change: F290Y

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 127 249 4e-9 SMART
Blast:WD40 136 175 3e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000112040
AA Change: F290Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000107671
Gene: ENSMUSG00000054087
AA Change: F290Y

DomainStartEndE-ValueType
FBOX 5 45 3.13e-6 SMART
SCOP:d1tbga_ 127 249 4e-9 SMART
Blast:WD40 136 175 4e-6 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000196351
SMART Domains Protein: ENSMUSP00000143357
Gene: ENSMUSG00000054087

DomainStartEndE-ValueType
FBOX 5 45 2e-8 SMART
SCOP:d1aym1_ 54 102 2e-3 SMART
Blast:WD40 172 211 5e-6 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000200156
AA Change: F237Y

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000143361
Gene: ENSMUSG00000054087
AA Change: F237Y

DomainStartEndE-ValueType
FBOX 5 45 2e-8 SMART
SCOP:d1tbga_ 127 208 2e-3 SMART
Blast:WD40 136 175 4e-6 BLAST
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Fbxw28
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01883:Fbxw28 APN 9 109328325 missense probably benign 0.05
IGL02080:Fbxw28 APN 9 109339573 missense probably damaging 1.00
IGL02313:Fbxw28 APN 9 109337352 missense possibly damaging 0.76
R0029:Fbxw28 UTSW 9 109328289 missense probably damaging 1.00
R0038:Fbxw28 UTSW 9 109338540 missense probably damaging 1.00
R0058:Fbxw28 UTSW 9 109328211 missense probably benign 0.22
R1288:Fbxw28 UTSW 9 109337293 missense probably damaging 0.97
R1898:Fbxw28 UTSW 9 109323384 missense probably benign 0.32
R2065:Fbxw28 UTSW 9 109328224 missense probably benign 0.03
R2117:Fbxw28 UTSW 9 109330917 missense probably benign 0.04
R3410:Fbxw28 UTSW 9 109338404 missense possibly damaging 0.55
R3812:Fbxw28 UTSW 9 109338530 missense possibly damaging 0.83
R4840:Fbxw28 UTSW 9 109339534 missense probably null 1.00
R4899:Fbxw28 UTSW 9 109330853 missense probably damaging 0.99
R5129:Fbxw28 UTSW 9 109326603 missense probably damaging 1.00
R5613:Fbxw28 UTSW 9 109338533 missense probably benign 0.02
R5777:Fbxw28 UTSW 9 109338536 missense probably damaging 0.98
R6029:Fbxw28 UTSW 9 109329425 missense probably damaging 1.00
R6235:Fbxw28 UTSW 9 109326190 missense probably damaging 1.00
R6367:Fbxw28 UTSW 9 109339531 critical splice donor site probably null
R6820:Fbxw28 UTSW 9 109338425 missense probably damaging 1.00
R6968:Fbxw28 UTSW 9 109330788 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TTTTGTTTGTGAGACAGCAGCC -3'
(R):5'- TTTGAAAGCCACTTGTCTTGAGTG -3'

Sequencing Primer
(F):5'- TGTGAGACAGCAGCCTCTATG -3'
(R):5'- CCACTTGTCTTGAGTGTGCCTG -3'
Posted On2015-07-07