Incidental Mutation 'R4400:Bves'
ID326596
Institutional Source Beutler Lab
Gene Symbol Bves
Ensembl Gene ENSMUSG00000071317
Gene Nameblood vessel epicardial substance
SynonymsPopdc1, popeye 1
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location45335772-45372479 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45369293 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 354 (V354A)
Ref Sequence ENSEMBL: ENSMUSP00000093382 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000095715]
Predicted Effect probably benign
Transcript: ENSMUST00000095715
AA Change: V354A

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000093382
Gene: ENSMUSG00000071317
AA Change: V354A

DomainStartEndE-ValueType
Pfam:Popeye 40 267 3e-90 PFAM
low complexity region 313 323 N/A INTRINSIC
low complexity region 336 347 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the POP family of proteins containing three putative transmembrane domains. This gene is expressed in cardiac and skeletal muscle and may play an important role in development of these tissues. The mouse ortholog may be involved in the regeneration of adult skeletal muscle and may act as a cell adhesion molecule in coronary vasculogenesis. Three transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygous mutation of this gene results in delayed muscle regeneration following induced injury. Mice homozygous for a knock-out allele exhibit sinus brachycardia in response to physical or mental stress and catecholamines with a compact sinoatrial node. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubqln1 T A 13: 58,193,388 N183I probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Bves
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01128:Bves APN 10 45353848 missense probably damaging 1.00
IGL01155:Bves APN 10 45353859 missense probably damaging 1.00
IGL01482:Bves APN 10 45354806 missense possibly damaging 0.68
R1402:Bves UTSW 10 45347865 missense probably damaging 1.00
R1402:Bves UTSW 10 45347865 missense probably damaging 1.00
R1564:Bves UTSW 10 45369281 missense probably benign 0.03
R1711:Bves UTSW 10 45347865 missense probably damaging 1.00
R1742:Bves UTSW 10 45347865 missense probably damaging 1.00
R2057:Bves UTSW 10 45343135 missense probably damaging 1.00
R3113:Bves UTSW 10 45343052 missense probably benign 0.01
R3546:Bves UTSW 10 45354811 missense probably damaging 1.00
R4612:Bves UTSW 10 45339277 missense probably benign 0.01
R4687:Bves UTSW 10 45354840 synonymous probably null
R6994:Bves UTSW 10 45339418 missense probably benign
R7052:Bves UTSW 10 45346290 missense possibly damaging 0.69
R7179:Bves UTSW 10 45354817 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AACCACTTGATTGAGACTTCGAGG -3'
(R):5'- AGTCAGAAGGCTTGGCTAAC -3'

Sequencing Primer
(F):5'- AGGGTGCTGAGTTTCCAGAAG -3'
(R):5'- CTTGGCTAACACAAGGAGCTG -3'
Posted On2015-07-07