Mutagenetix > Incidental Mutation

Incidental Mutation 'R4400:Prpf8'

326598

Institutional Source

Beutler Lab

Gene Symbol

Prpf8

Ensembl Gene

ENSMUSG00000020850

Gene Name

pre-mRNA processing factor 8

Synonyms

Sfprp8l, D11Bwg0410e, DBF3/PRP8, Prp8

MMRRC Submission

041131-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.958) question?

Stock #

R4400 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

75377642-75400275 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 75381528 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 255 (T255A)

Ref Sequence

ENSEMBL: ENSMUSP00000115635 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000018449] [ENSMUST00000102510] [ENSMUST00000131283]

AlphaFold

Q99PV0

Predicted Effect

possibly damaging
Transcript: ENSMUST00000018449
AA Change: T310A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000018449
Gene: ENSMUSG00000020850
AA Change: T310A

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-84	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	393	801	3.6e-226	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1079	7.1e-49	PFAM
Pfam:U5_2-snRNA_bdg	1208	1343	1.9e-73	PFAM
Pfam:U6-snRNA_bdg	1442	1601	3.7e-97	PFAM
Pfam:PRP8_domainIV	1760	1990	1.5e-132	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000102510
AA Change: T310A

PolyPhen 2 Score 0.528 (Sensitivity: 0.88; Specificity: 0.90)

SMART Domains

Protein: ENSMUSP00000099568
Gene: ENSMUSG00000020850
AA Change: T310A

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	209	1.6e-90	PFAM
low complexity region	369	388	N/A	INTRINSIC
Pfam:PROCN	395	801	2.9e-239	PFAM
low complexity region	802	814	N/A	INTRINSIC
Pfam:RRM_4	986	1077	1.5e-51	PFAM
Pfam:U5_2-snRNA_bdg	1210	1343	1.1e-77	PFAM
Pfam:U6-snRNA_bdg	1442	1600	4.2e-97	PFAM
Pfam:PRP8_domainIV	1760	1989	9.8e-134	PFAM
JAB_MPN	2099	2233	9.02e-30	SMART

Predicted Effect

possibly damaging
Transcript: ENSMUST00000131283
AA Change: T255A

PolyPhen 2 Score 0.630 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000115635
Gene: ENSMUSG00000020850
AA Change: T255A

Domain	Start	End	E-Value	Type
Pfam:PRO8NT	58	92	1.9e-13	PFAM
Pfam:PRO8NT	90	154	2.5e-30	PFAM
low complexity region	314	333	N/A	INTRINSIC
Pfam:PROCN	338	746	1.7e-226	PFAM
low complexity region	747	759	N/A	INTRINSIC
Pfam:RRM_4	931	1024	5.3e-49	PFAM

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000133995

Coding Region Coverage

1x: 99.3%
3x: 98.6%
10x: 97.0%
20x: 94.3%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Pre-mRNA splicing occurs in 2 sequential transesterification steps. The protein encoded by this gene is a component of both U2- and U12-dependent spliceosomes, and found to be essential for the catalytic step II in pre-mRNA splicing process. It contains several WD repeats, which function in protein-protein interactions. This protein has a sequence similarity to yeast Prp8 protein. This gene is a candidate gene for autosomal dominant retinitis pigmentosa. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice that are either heterozygous or homozygous for a knock-in allele exhibit abnormal retinal pigment epithelium morphology and late-onset retinal degeneration. These changes are more severe in homozygous mutant mice. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 42 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Atp4b	A	G	8: 13,438,810 (GRCm39)	F189L	probably damaging	Het
Atp8a1	A	T	5: 67,922,221 (GRCm39)	Y372N	probably benign	Het
Bves	T	C	10: 45,245,389 (GRCm39)	V354A	probably benign	Het
Cd79b	A	T	11: 106,202,836 (GRCm39)	Y195*	probably null	Het
Cog6	A	C	3: 52,920,362 (GRCm39)	D131E	probably benign	Het
Elp3	C	T	14: 65,785,539 (GRCm39)	E421K	possibly damaging	Het
Fbxw28	A	T	9: 109,157,378 (GRCm39)	F237Y	probably damaging	Het
Fezf1	T	C	6: 23,247,709 (GRCm39)	N122S	probably benign	Het
Galnt2	A	G	8: 125,051,042 (GRCm39)	K157E	probably damaging	Het
Git2	T	C	5: 114,871,970 (GRCm39)	E141G	possibly damaging	Het
Gm26888	T	C	11: 119,044,853 (GRCm39)		silent	Het
Gnrhr	T	C	5: 86,330,108 (GRCm39)		probably null	Het
Hoxd13	A	T	2: 74,500,359 (GRCm39)	D300V	probably damaging	Het
Hspg2	G	A	4: 137,275,433 (GRCm39)	A2748T	probably benign	Het
Hyal2	A	G	9: 107,448,052 (GRCm39)	N235S	probably damaging	Het
Itgam	T	G	7: 127,680,830 (GRCm39)	L253R	probably damaging	Het
Kcnh8	GAGACCAACGAGCAGCTGATGCTTCAGA	GAGA	17: 53,032,934 (GRCm39)	74	probably benign	Het
Matr3	A	T	18: 35,716,969 (GRCm39)	K591N	possibly damaging	Het
Mep1a	T	A	17: 43,785,897 (GRCm39)	I731F	possibly damaging	Het
Mrtfa	G	A	15: 80,905,124 (GRCm39)	Q103*	probably null	Het
Muc5b	A	G	7: 141,415,124 (GRCm39)	D2690G	possibly damaging	Het
Nlrc5	A	G	8: 95,220,981 (GRCm39)	Q1140R	probably benign	Het
Or14c39	A	G	7: 86,343,798 (GRCm39)	I45V	probably benign	Het
Or5ac23	C	T	16: 59,148,961 (GRCm39)	V304I	probably benign	Het
Or6b6	A	G	7: 106,571,209 (GRCm39)	L114P	probably damaging	Het
Plcl1	T	C	1: 55,754,736 (GRCm39)	F1028L	probably damaging	Het
Plpp2	A	G	10: 79,363,327 (GRCm39)	V106A	possibly damaging	Het
Shoc2	A	G	19: 54,019,660 (GRCm39)	I568V	probably benign	Het
Spopl	C	T	2: 23,407,957 (GRCm39)	V241M	probably damaging	Het
Ssrp1	A	T	2: 84,868,285 (GRCm39)	D9V	probably damaging	Het
Strn3	A	T	12: 51,694,883 (GRCm39)	D293E	possibly damaging	Het
Tbx3	G	T	5: 119,818,636 (GRCm39)	D404Y	probably damaging	Het
Tdrd7	T	C	4: 46,005,540 (GRCm39)	S416P	possibly damaging	Het
Trim60	G	T	8: 65,453,864 (GRCm39)	Y128*	probably null	Het
Tspoap1	T	C	11: 87,666,429 (GRCm39)	S947P	probably damaging	Het
Ttn	A	T	2: 76,612,739 (GRCm39)	S17113R	probably damaging	Het
Ubqln1	T	A	13: 58,341,202 (GRCm39)	N183I	probably damaging	Het
Ubr4	A	G	4: 139,189,167 (GRCm39)	N3917D	possibly damaging	Het
Ucp2	A	G	7: 100,148,557 (GRCm39)	*310W	probably null	Het
Wdr76	A	G	2: 121,359,314 (GRCm39)	M218V	probably damaging	Het
Zranb3	A	C	1: 127,884,392 (GRCm39)	L998R	possibly damaging	Het
Zxdc	G	A	6: 90,346,792 (GRCm39)	G51E	probably damaging	Het

Other mutations in Prpf8

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01375:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01376:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01393:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01395:Prpf8	APN	11	75,385,121 (GRCm39)	missense	possibly damaging	0.94
IGL01554:Prpf8	APN	11	75,386,472 (GRCm39)	missense	probably damaging	1.00
IGL01560:Prpf8	APN	11	75,381,232 (GRCm39)	missense	possibly damaging	0.55
IGL01886:Prpf8	APN	11	75,386,570 (GRCm39)	missense	probably benign	0.32
IGL01946:Prpf8	APN	11	75,390,818 (GRCm39)	missense	probably damaging	1.00
IGL02022:Prpf8	APN	11	75,392,660 (GRCm39)	nonsense	probably null
IGL02077:Prpf8	APN	11	75,386,635 (GRCm39)	missense	probably damaging	0.96
IGL02141:Prpf8	APN	11	75,381,498 (GRCm39)	missense	possibly damaging	0.68
IGL02455:Prpf8	APN	11	75,400,084 (GRCm39)	missense	probably benign	0.32
cutter	UTSW	11	75,386,252 (GRCm39)	splice site	probably null
BB009:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
BB019:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
PIT4514001:Prpf8	UTSW	11	75,387,181 (GRCm39)	missense	possibly damaging	0.53
R0254:Prpf8	UTSW	11	75,397,188 (GRCm39)	missense	possibly damaging	0.93
R0270:Prpf8	UTSW	11	75,396,075 (GRCm39)	missense	probably damaging	0.99
R0504:Prpf8	UTSW	11	75,392,768 (GRCm39)	splice site	probably benign
R0573:Prpf8	UTSW	11	75,381,480 (GRCm39)	missense	probably damaging	1.00
R0613:Prpf8	UTSW	11	75,394,270 (GRCm39)	missense	probably damaging	1.00
R0893:Prpf8	UTSW	11	75,384,775 (GRCm39)	missense	probably damaging	1.00
R0967:Prpf8	UTSW	11	75,385,256 (GRCm39)	missense	probably damaging	1.00
R0975:Prpf8	UTSW	11	75,399,500 (GRCm39)	unclassified	probably benign
R1123:Prpf8	UTSW	11	75,386,111 (GRCm39)	missense	probably damaging	1.00
R1183:Prpf8	UTSW	11	75,381,156 (GRCm39)	missense	possibly damaging	0.95
R1857:Prpf8	UTSW	11	75,386,249 (GRCm39)	critical splice donor site	probably null
R1901:Prpf8	UTSW	11	75,395,570 (GRCm39)	missense	probably damaging	0.99
R1950:Prpf8	UTSW	11	75,387,337 (GRCm39)	missense	possibly damaging	0.72
R2116:Prpf8	UTSW	11	75,378,547 (GRCm39)	missense	possibly damaging	0.51
R2147:Prpf8	UTSW	11	75,381,357 (GRCm39)	missense	probably benign
R2185:Prpf8	UTSW	11	75,377,939 (GRCm39)	nonsense	probably null
R2271:Prpf8	UTSW	11	75,386,189 (GRCm39)	missense	probably damaging	1.00
R2272:Prpf8	UTSW	11	75,386,189 (GRCm39)	missense	probably damaging	1.00
R2898:Prpf8	UTSW	11	75,386,860 (GRCm39)	missense	probably benign	0.00
R3744:Prpf8	UTSW	11	75,397,547 (GRCm39)	splice site	probably null
R3893:Prpf8	UTSW	11	75,391,083 (GRCm39)	missense	possibly damaging	0.73
R4510:Prpf8	UTSW	11	75,382,652 (GRCm39)	missense	probably damaging	0.96
R4511:Prpf8	UTSW	11	75,382,652 (GRCm39)	missense	probably damaging	0.96
R4784:Prpf8	UTSW	11	75,383,331 (GRCm39)	missense	probably damaging	1.00
R5089:Prpf8	UTSW	11	75,400,054 (GRCm39)	splice site	probably null
R5186:Prpf8	UTSW	11	75,380,609 (GRCm39)	missense	possibly damaging	0.93
R5215:Prpf8	UTSW	11	75,391,030 (GRCm39)	missense	probably benign	0.02
R5288:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5362:Prpf8	UTSW	11	75,397,236 (GRCm39)	missense	possibly damaging	0.53
R5384:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5386:Prpf8	UTSW	11	75,386,625 (GRCm39)	missense	probably damaging	1.00
R5423:Prpf8	UTSW	11	75,399,784 (GRCm39)	missense	probably damaging	1.00
R5472:Prpf8	UTSW	11	75,394,469 (GRCm39)	missense	possibly damaging	0.89
R5539:Prpf8	UTSW	11	75,394,464 (GRCm39)	missense	probably benign	0.20
R5620:Prpf8	UTSW	11	75,395,927 (GRCm39)	missense	possibly damaging	0.95
R5669:Prpf8	UTSW	11	75,395,564 (GRCm39)	missense	probably damaging	1.00
R5887:Prpf8	UTSW	11	75,391,734 (GRCm39)	missense	possibly damaging	0.87
R5948:Prpf8	UTSW	11	75,400,015 (GRCm39)	missense	possibly damaging	0.95
R6073:Prpf8	UTSW	11	75,384,848 (GRCm39)	critical splice donor site	probably null
R6250:Prpf8	UTSW	11	75,384,334 (GRCm39)	missense	possibly damaging	0.95
R6358:Prpf8	UTSW	11	75,382,321 (GRCm39)	missense	probably benign	0.33
R6629:Prpf8	UTSW	11	75,386,252 (GRCm39)	splice site	probably null
R6804:Prpf8	UTSW	11	75,390,635 (GRCm39)	missense	possibly damaging	0.71
R6922:Prpf8	UTSW	11	75,381,562 (GRCm39)	missense	probably damaging	1.00
R7035:Prpf8	UTSW	11	75,395,654 (GRCm39)	missense	possibly damaging	0.72
R7038:Prpf8	UTSW	11	75,386,984 (GRCm39)	missense	probably benign	0.02
R7089:Prpf8	UTSW	11	75,399,374 (GRCm39)	missense	probably damaging	0.99
R7101:Prpf8	UTSW	11	75,381,226 (GRCm39)	missense	possibly damaging	0.85
R7114:Prpf8	UTSW	11	75,394,181 (GRCm39)	nonsense	probably null
R7182:Prpf8	UTSW	11	75,381,553 (GRCm39)	missense	possibly damaging	0.96
R7290:Prpf8	UTSW	11	75,384,783 (GRCm39)	missense	possibly damaging	0.85
R7323:Prpf8	UTSW	11	75,382,610 (GRCm39)	missense	probably benign	0.32
R7485:Prpf8	UTSW	11	75,399,738 (GRCm39)	nonsense	probably null
R7522:Prpf8	UTSW	11	75,400,102 (GRCm39)	missense	possibly damaging	0.82
R7546:Prpf8	UTSW	11	75,399,200 (GRCm39)	missense	probably damaging	1.00
R7596:Prpf8	UTSW	11	75,382,330 (GRCm39)	missense	probably benign	0.03
R7699:Prpf8	UTSW	11	75,391,022 (GRCm39)	missense	probably benign	0.02
R7731:Prpf8	UTSW	11	75,399,732 (GRCm39)	missense	probably damaging	0.97
R7821:Prpf8	UTSW	11	75,385,300 (GRCm39)	missense	probably benign	0.01
R7932:Prpf8	UTSW	11	75,383,423 (GRCm39)	missense	possibly damaging	0.92
R8039:Prpf8	UTSW	11	75,393,368 (GRCm39)	missense	possibly damaging	0.95
R8067:Prpf8	UTSW	11	75,390,976 (GRCm39)	missense	probably damaging	0.98
R8316:Prpf8	UTSW	11	75,390,641 (GRCm39)	missense	possibly damaging	0.71
R8560:Prpf8	UTSW	11	75,382,600 (GRCm39)	nonsense	probably null
R8823:Prpf8	UTSW	11	75,384,282 (GRCm39)	missense	probably benign	0.05
R8977:Prpf8	UTSW	11	75,386,870 (GRCm39)	missense	probably benign	0.12
R9116:Prpf8	UTSW	11	75,380,589 (GRCm39)	missense	possibly damaging	0.71
R9166:Prpf8	UTSW	11	75,387,340 (GRCm39)	missense	possibly damaging	0.53
R9360:Prpf8	UTSW	11	75,381,156 (GRCm39)	missense	possibly damaging	0.95
R9453:Prpf8	UTSW	11	75,397,212 (GRCm39)	missense	possibly damaging	0.56
R9518:Prpf8	UTSW	11	75,394,486 (GRCm39)	missense	possibly damaging	0.72
R9532:Prpf8	UTSW	11	75,385,608 (GRCm39)	missense	probably benign	0.01
R9626:Prpf8	UTSW	11	75,385,681 (GRCm39)	missense	possibly damaging	0.53
R9760:Prpf8	UTSW	11	75,394,257 (GRCm39)	missense	probably benign	0.20
X0028:Prpf8	UTSW	11	75,397,590 (GRCm39)	missense	probably damaging	0.99
Z1177:Prpf8	UTSW	11	75,394,160 (GRCm39)	missense	probably benign	0.35

Predicted Primers

PCR Primer
(F):5'- CACTCAACATGGCCATTCCTG -3'
(R):5'- CTTGATGAACACAACGTTGGGAG -3'

Sequencing Primer
(F):5'- GGGACCCAAATTTGAGCCTCTTG -3'
(R):5'- AACGTTGGGAGTGTGGTACCTATAAC -3'

Posted On

2015-07-07