Incidental Mutation 'R4400:Ubqln1'
ID326602
Institutional Source Beutler Lab
Gene Symbol Ubqln1
Ensembl Gene ENSMUSG00000005312
Gene Nameubiquilin 1
SynonymsXDRP1, Plic-1, Dsk2, DA41, D13Ertd372e, 1110046H03Rik, 1810030E05Rik
MMRRC Submission 041131-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.630) question?
Stock #R4400 (G1)
Quality Score225
Status Not validated
Chromosome13
Chromosomal Location58176156-58215653 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 58193388 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Isoleucine at position 183 (N183I)
Ref Sequence ENSEMBL: ENSMUSP00000075782 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000058735] [ENSMUST00000076454]
Predicted Effect probably damaging
Transcript: ENSMUST00000058735
AA Change: N183I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000050191
Gene: ENSMUSG00000005312
AA Change: N183I

DomainStartEndE-ValueType
UBQ 28 98 7.78e-16 SMART
low complexity region 136 154 N/A INTRINSIC
STI1 173 201 6e0 SMART
STI1 203 242 6.75e-10 SMART
low complexity region 316 356 N/A INTRINSIC
STI1 381 428 2.62e-7 SMART
STI1 432 464 3.1e0 SMART
low complexity region 483 499 N/A INTRINSIC
UBA 540 578 1.77e-6 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076454
AA Change: N183I

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000075782
Gene: ENSMUSG00000005312
AA Change: N183I

DomainStartEndE-ValueType
UBQ 28 98 7.78e-16 SMART
low complexity region 136 154 N/A INTRINSIC
STI1 173 201 6e0 SMART
STI1 203 242 6.75e-10 SMART
low complexity region 316 356 N/A INTRINSIC
STI1 381 420 2.24e-6 SMART
low complexity region 455 471 N/A INTRINSIC
UBA 512 550 1.77e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000224851
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.6%
  • 10x: 97.0%
  • 20x: 94.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an ubiquitin-like protein (ubiquilin) that shares a high degree of similarity with related products in yeast, rat and frog. Ubiquilins contain an N-terminal ubiquitin-like domain and a C-terminal ubiquitin-associated domain. They physically associate with both proteasomes and ubiquitin ligases, and thus are thought to functionally link the ubiquitination machinery to the proteasome to affect in vivo protein degradation. This ubiquilin has also been shown to modulate accumulation of presenilin proteins, and it is found in lesions associated with Alzheimer's and Parkinson's disease. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null animals display impaired degradation of ubiquitinated proteins in the brain, increased ischemia/reperfusion-caused brain injury, and slower functional recovery after injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Atp4b A G 8: 13,388,810 F189L probably damaging Het
Atp8a1 A T 5: 67,764,878 Y372N probably benign Het
Bves T C 10: 45,369,293 V354A probably benign Het
Cd79b A T 11: 106,312,010 Y195* probably null Het
Cog6 A C 3: 53,012,941 D131E probably benign Het
Elp3 C T 14: 65,548,090 E421K possibly damaging Het
Fbxw28 A T 9: 109,328,310 F237Y probably damaging Het
Fezf1 T C 6: 23,247,710 N122S probably benign Het
Galnt2 A G 8: 124,324,303 K157E probably damaging Het
Git2 T C 5: 114,733,909 E141G possibly damaging Het
Gm26888 T C 11: 119,154,027 silent Het
Gnrhr T C 5: 86,182,249 probably null Het
Hoxd13 A T 2: 74,670,015 D300V probably damaging Het
Hspg2 G A 4: 137,548,122 A2748T probably benign Het
Hyal2 A G 9: 107,570,853 N235S probably damaging Het
Itgam T G 7: 128,081,658 L253R probably damaging Het
Kcnh8 GAGACCAACGAGCAGCTGATGCTTCAGA GAGA 17: 52,725,906 probably benign Het
Matr3 A T 18: 35,583,916 K591N possibly damaging Het
Mep1a T A 17: 43,475,006 I731F possibly damaging Het
Mkl1 G A 15: 81,020,923 Q103* probably null Het
Muc5b A G 7: 141,861,387 D2690G possibly damaging Het
Nlrc5 A G 8: 94,494,353 Q1140R probably benign Het
Olfr205 C T 16: 59,328,598 V304I probably benign Het
Olfr292 A G 7: 86,694,590 I45V probably benign Het
Olfr711 A G 7: 106,972,002 L114P probably damaging Het
Plcl1 T C 1: 55,715,577 F1028L probably damaging Het
Plpp2 A G 10: 79,527,493 V106A possibly damaging Het
Prpf8 A G 11: 75,490,702 T255A possibly damaging Het
Shoc2 A G 19: 54,031,229 I568V probably benign Het
Spopl C T 2: 23,517,945 V241M probably damaging Het
Ssrp1 A T 2: 85,037,941 D9V probably damaging Het
Strn3 A T 12: 51,648,100 D293E possibly damaging Het
Tbx3 G T 5: 119,680,571 D404Y probably damaging Het
Tdrd7 T C 4: 46,005,540 S416P possibly damaging Het
Trim60 G T 8: 65,001,212 Y128* probably null Het
Tspoap1 T C 11: 87,775,603 S947P probably damaging Het
Ttn A T 2: 76,782,395 S17113R probably damaging Het
Ubr4 A G 4: 139,461,856 N3917D possibly damaging Het
Ucp2 A G 7: 100,499,350 *310W probably null Het
Wdr76 A G 2: 121,528,833 M218V probably damaging Het
Zranb3 A C 1: 127,956,655 L998R possibly damaging Het
Zxdc G A 6: 90,369,810 G51E probably damaging Het
Other mutations in Ubqln1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Ubqln1 APN 13 58177992 nonsense probably null
IGL01566:Ubqln1 APN 13 58179667 splice site probably null
IGL02160:Ubqln1 APN 13 58192137 missense probably damaging 1.00
IGL03171:Ubqln1 APN 13 58180858 missense probably damaging 1.00
R0140:Ubqln1 UTSW 13 58193289 missense probably damaging 1.00
R1676:Ubqln1 UTSW 13 58179391 missense possibly damaging 0.67
R1712:Ubqln1 UTSW 13 58192081 missense probably damaging 1.00
R5194:Ubqln1 UTSW 13 58199033 missense probably benign
R5419:Ubqln1 UTSW 13 58183183 missense probably damaging 0.99
R5778:Ubqln1 UTSW 13 58183317 missense probably benign 0.00
R6198:Ubqln1 UTSW 13 58196590 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCCTAAATAATGGTTGGGATTCTCTC -3'
(R):5'- GGGTACACTTCATACCTAAGCCG -3'

Sequencing Primer
(F):5'- AAAATACACAAGGCAATCTCTGG -3'
(R):5'- TTCATACCTAAGCCGTAGCATAG -3'
Posted On2015-07-07