Incidental Mutation 'R4401:Cytip'
ID326616
Institutional Source Beutler Lab
Gene Symbol Cytip
Ensembl Gene ENSMUSG00000026832
Gene Namecytohesin 1 interacting protein
SynonymsA130053M09Rik, Pscdbp, Cybr, Cbp
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4401 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location58129137-58195532 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 58133935 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 291 (D291G)
Ref Sequence ENSEMBL: ENSMUSP00000028175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000028175]
Predicted Effect probably benign
Transcript: ENSMUST00000028175
AA Change: D291G

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000028175
Gene: ENSMUSG00000026832
AA Change: D291G

DomainStartEndE-ValueType
PDZ 86 166 6.88e-13 SMART
low complexity region 177 188 N/A INTRINSIC
low complexity region 240 253 N/A INTRINSIC
low complexity region 295 306 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131443
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144117
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148764
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains 2 leucine zipper domains and a putative C-terminal nuclear targeting signal, but does not have any hydrophobic regions. This protein is expressed weakly in resting NK and T cells. The encoded protein modulates the activation of ARF genes by CYTH1. This protein interacts with CYTH1 and SNX27 proteins and may act to sequester CYTH1 protein in the cytoplasm.[provided by RefSeq, Aug 2008]
PHENOTYPE: Mice homozygous for a null allele display impaired trafficking and/or cell adhesion of immune system cells. Mice homozygous for a reporter allele show normal immune cell development and function; however, mutant hematopoietic stems cells have impaired repopulating activity. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Cytip
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01635:Cytip APN 2 58148231 missense probably damaging 1.00
IGL01670:Cytip APN 2 58133773 missense probably damaging 1.00
IGL02184:Cytip APN 2 58133738 missense probably damaging 1.00
IGL02271:Cytip APN 2 58133860 nonsense probably null
IGL02468:Cytip APN 2 58134013 missense probably benign 0.08
R0079:Cytip UTSW 2 58159994 missense probably benign 0.37
R0304:Cytip UTSW 2 58148246 missense possibly damaging 0.87
R0612:Cytip UTSW 2 58134190 missense possibly damaging 0.46
R1448:Cytip UTSW 2 58145180 missense probably damaging 1.00
R1822:Cytip UTSW 2 58134146 missense probably benign 0.00
R1954:Cytip UTSW 2 58148253 missense possibly damaging 0.75
R4578:Cytip UTSW 2 58160012 missense possibly damaging 0.95
R5101:Cytip UTSW 2 58147899 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCTTCCACTGCACGATGAAGG -3'
(R):5'- TCGTCCTTGTTTGGAAATCTGC -3'

Sequencing Primer
(F):5'- GGCCAGGGATGAATTTCAAAATTTG -3'
(R):5'- AAATCTGCTGGGGCCGAGTC -3'
Posted On2015-07-07