Incidental Mutation 'R4401:Fnbp4'
ID326617
Institutional Source Beutler Lab
Gene Symbol Fnbp4
Ensembl Gene ENSMUSG00000008200
Gene Nameformin binding protein 4
SynonymsFBP30
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.918) question?
Stock #R4401 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location90745370-90781021 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 90746758 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Alanine at position 145 (T145A)
Ref Sequence ENSEMBL: ENSMUSP00000013759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000013759]
Predicted Effect possibly damaging
Transcript: ENSMUST00000013759
AA Change: T145A

PolyPhen 2 Score 0.620 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000013759
Gene: ENSMUSG00000008200
AA Change: T145A

DomainStartEndE-ValueType
low complexity region 65 140 N/A INTRINSIC
low complexity region 165 175 N/A INTRINSIC
low complexity region 204 235 N/A INTRINSIC
WW 265 298 3.58e-5 SMART
low complexity region 372 381 N/A INTRINSIC
low complexity region 386 393 N/A INTRINSIC
low complexity region 404 416 N/A INTRINSIC
coiled coil region 442 478 N/A INTRINSIC
low complexity region 515 533 N/A INTRINSIC
WW 650 683 1.77e-9 SMART
low complexity region 757 788 N/A INTRINSIC
low complexity region 891 909 N/A INTRINSIC
low complexity region 955 1002 N/A INTRINSIC
low complexity region 1018 1032 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117928
Predicted Effect noncoding transcript
Transcript: ENSMUST00000123314
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Fnbp4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00392:Fnbp4 APN 2 90751622 splice site probably benign
IGL00731:Fnbp4 APN 2 90768643 missense probably benign
IGL01021:Fnbp4 APN 2 90777669 missense probably benign 0.06
IGL01097:Fnbp4 APN 2 90776350 missense possibly damaging 0.63
IGL02504:Fnbp4 APN 2 90768543 missense probably damaging 1.00
IGL02510:Fnbp4 APN 2 90751475 missense probably benign
IGL02673:Fnbp4 APN 2 90763472 missense probably benign 0.01
IGL03024:Fnbp4 APN 2 90751179 missense probably benign 0.11
IGL03221:Fnbp4 APN 2 90777718 missense possibly damaging 0.65
R0570:Fnbp4 UTSW 2 90752957 missense probably damaging 1.00
R1914:Fnbp4 UTSW 2 90779193 unclassified probably benign
R1925:Fnbp4 UTSW 2 90765843 missense probably damaging 1.00
R2051:Fnbp4 UTSW 2 90757532 missense probably benign 0.05
R2069:Fnbp4 UTSW 2 90758372 missense probably damaging 1.00
R2165:Fnbp4 UTSW 2 90767399 splice site probably null
R2262:Fnbp4 UTSW 2 90757404 missense probably damaging 1.00
R3836:Fnbp4 UTSW 2 90746785 missense probably damaging 1.00
R4077:Fnbp4 UTSW 2 90758477 nonsense probably null
R4356:Fnbp4 UTSW 2 90758339 missense probably damaging 1.00
R4491:Fnbp4 UTSW 2 90752968 critical splice donor site probably null
R4914:Fnbp4 UTSW 2 90751169 missense probably benign 0.00
R4981:Fnbp4 UTSW 2 90765830 missense probably damaging 1.00
R5165:Fnbp4 UTSW 2 90777657 missense possibly damaging 0.65
R5272:Fnbp4 UTSW 2 90753115 missense probably benign
R5683:Fnbp4 UTSW 2 90752862 missense probably damaging 1.00
R5860:Fnbp4 UTSW 2 90757482 missense probably benign 0.00
R5905:Fnbp4 UTSW 2 90751134 missense probably benign 0.29
R5914:Fnbp4 UTSW 2 90774793 intron probably benign
R6028:Fnbp4 UTSW 2 90751134 missense probably benign 0.29
R6270:Fnbp4 UTSW 2 90757463 missense probably damaging 1.00
R6379:Fnbp4 UTSW 2 90751124 missense probably benign 0.41
R6389:Fnbp4 UTSW 2 90745535 missense unknown
R6885:Fnbp4 UTSW 2 90745828 critical splice donor site probably null
R6940:Fnbp4 UTSW 2 90745514 missense unknown
Predicted Primers PCR Primer
(F):5'- CTTAGTTTGCATCAGTGATACACG -3'
(R):5'- AGTGGAACCCAGAGTTTTGC -3'

Sequencing Primer
(F):5'- CACGCTGGTTTTATAAGTTGATTCAG -3'
(R):5'- GTGGAACCCAGAGTTTTGCATCTC -3'
Posted On2015-07-07