Incidental Mutation 'R4401:Slc9b2'
ID326620
Institutional Source Beutler Lab
Gene Symbol Slc9b2
Ensembl Gene ENSMUSG00000037994
Gene Namesolute carrier family 9, subfamily B (NHA2, cation proton antiporter 2), member 2
SynonymsC80638, nha-oc, Nhedc2, NHE10, NHA2
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R4401 (G1)
Quality Score225
Status Not validated
Chromosome3
Chromosomal Location135307700-135345387 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 135336544 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 528 (V528A)
Ref Sequence ENSEMBL: ENSMUSP00000060640 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051849] [ENSMUST00000145195]
Predicted Effect probably benign
Transcript: ENSMUST00000051849
AA Change: V528A

PolyPhen 2 Score 0.041 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000060640
Gene: ENSMUSG00000037994
AA Change: V528A

DomainStartEndE-ValueType
transmembrane domain 83 102 N/A INTRINSIC
Pfam:Na_H_Exchanger 116 515 4.4e-32 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132405
Predicted Effect probably benign
Transcript: ENSMUST00000145195
SMART Domains Protein: ENSMUSP00000123083
Gene: ENSMUSG00000037994

DomainStartEndE-ValueType
transmembrane domain 21 43 N/A INTRINSIC
transmembrane domain 47 69 N/A INTRINSIC
Meta Mutation Damage Score 0.194 question?
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Sodium hydrogen antiporters, such as NHEDC2, convert the proton motive force established by the respiratory chain or the F1F0 mitochondrial ATPase into sodium gradients that drive other energy-requiring processes, transduce environmental signals into cell responses, or function in drug efflux (Xiang et al., 2007 [PubMed 18000046]).[supplied by OMIM, Mar 2008]
PHENOTYPE: Mice homozygous for a gene trapped allele are viable and overtly normal, with no detectable abnormalities in osteoclast differentiation and function. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Slc9b2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01626:Slc9b2 APN 3 135336395 missense probably benign 0.17
IGL03091:Slc9b2 APN 3 135329030 missense probably damaging 0.97
IGL03203:Slc9b2 APN 3 135326212 missense probably damaging 1.00
IGL03377:Slc9b2 APN 3 135336358 missense probably damaging 1.00
IGL02988:Slc9b2 UTSW 3 135318418 missense probably benign 0.02
R0008:Slc9b2 UTSW 3 135336508 missense possibly damaging 0.72
R0382:Slc9b2 UTSW 3 135318422 missense probably damaging 0.99
R0628:Slc9b2 UTSW 3 135323775 splice site probably benign
R1263:Slc9b2 UTSW 3 135336395 missense probably benign 0.17
R1478:Slc9b2 UTSW 3 135326102 missense probably benign 0.45
R1809:Slc9b2 UTSW 3 135317131 missense possibly damaging 0.90
R2060:Slc9b2 UTSW 3 135326266 missense probably damaging 0.99
R2119:Slc9b2 UTSW 3 135328982 splice site probably null
R3196:Slc9b2 UTSW 3 135336529 missense probably benign 0.04
R3805:Slc9b2 UTSW 3 135324588 missense probably damaging 1.00
R4127:Slc9b2 UTSW 3 135329837 missense probably benign 0.00
R4402:Slc9b2 UTSW 3 135336544 missense probably benign 0.04
R4622:Slc9b2 UTSW 3 135332518 missense probably damaging 1.00
R6125:Slc9b2 UTSW 3 135330696 splice site probably null
Predicted Primers PCR Primer
(F):5'- GCTAACACTTTCGTAGGCTGC -3'
(R):5'- CAGATGAGGCTATGGACCTTGG -3'

Sequencing Primer
(F):5'- AACACTTTCGTAGGCTGCCATTG -3'
(R):5'- AGGCTATGGACCTTGGTCTTTC -3'
Posted On2015-07-07