Incidental Mutation 'R4401:Pqlc2'
ID326621
Institutional Source Beutler Lab
Gene Symbol Pqlc2
Ensembl Gene ENSMUSG00000028744
Gene NamePQ loop repeat containing 2
Synonyms
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.174) question?
Stock #R4401 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location139294029-139310708 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 139306543 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 22 (I22V)
Ref Sequence ENSEMBL: ENSMUSP00000101427 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000053862] [ENSMUST00000073787] [ENSMUST00000105801] [ENSMUST00000139840] [ENSMUST00000141007] [ENSMUST00000172747]
Predicted Effect probably benign
Transcript: ENSMUST00000053862
AA Change: I22V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000059772
Gene: ENSMUSG00000028744
AA Change: I22V

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073787
SMART Domains Protein: ENSMUSP00000073459
Gene: ENSMUSG00000028743

DomainStartEndE-ValueType
low complexity region 3 21 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
Pfam:Aldo_ket_red 48 356 4.4e-54 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000105801
AA Change: I22V

PolyPhen 2 Score 0.192 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000101427
Gene: ENSMUSG00000028744
AA Change: I22V

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
low complexity region 333 344 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000139840
AA Change: I22V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000121362
Gene: ENSMUSG00000028744
AA Change: I22V

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000141007
AA Change: I22V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
Predicted Effect probably benign
Transcript: ENSMUST00000172747
AA Change: I22V

PolyPhen 2 Score 0.019 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000134464
Gene: ENSMUSG00000028744
AA Change: I22V

DomainStartEndE-ValueType
CTNS 51 83 8.63e-4 SMART
transmembrane domain 132 149 N/A INTRINSIC
CTNS 197 228 1.15e-8 SMART
transmembrane domain 251 273 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Pqlc2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01911:Pqlc2 APN 4 139301073 missense probably benign 0.01
R0030:Pqlc2 UTSW 4 139306453 missense probably damaging 1.00
R0332:Pqlc2 UTSW 4 139300299 missense possibly damaging 0.68
R1558:Pqlc2 UTSW 4 139300080 intron probably benign
R2157:Pqlc2 UTSW 4 139301855 missense probably damaging 1.00
R2518:Pqlc2 UTSW 4 139302499 missense probably damaging 1.00
R3079:Pqlc2 UTSW 4 139306518 missense probably damaging 1.00
R3778:Pqlc2 UTSW 4 139298982 splice site probably null
R4783:Pqlc2 UTSW 4 139300001 missense probably benign 0.00
R4784:Pqlc2 UTSW 4 139300001 missense probably benign 0.00
R4785:Pqlc2 UTSW 4 139300001 missense probably benign 0.00
R4879:Pqlc2 UTSW 4 139301784 splice site probably null
R5126:Pqlc2 UTSW 4 139302532 missense probably benign 0.27
R5540:Pqlc2 UTSW 4 139300344 missense probably damaging 0.99
R5700:Pqlc2 UTSW 4 139300254 missense probably damaging 1.00
R6141:Pqlc2 UTSW 4 139300245 missense probably benign 0.32
R6379:Pqlc2 UTSW 4 139299985 missense probably benign 0.02
R6905:Pqlc2 UTSW 4 139306441 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- ACCCAGTGCAGGACATGAAG -3'
(R):5'- GACTGTGAATGGGGCTAGAC -3'

Sequencing Primer
(F):5'- TGCAGGACATGAAGGACCACC -3'
(R):5'- CTCTCAAGGCTGAAGAGCTC -3'
Posted On2015-07-07