Incidental Mutation 'R4401:Vmn2r68'
ID326631
Institutional Source Beutler Lab
Gene Symbol Vmn2r68
Ensembl Gene ENSMUSG00000096861
Gene Namevomeronasal 2, receptor 68
SynonymsVmn2r68-ps, EG620697
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R4401 (G1)
Quality Score216
Status Not validated
Chromosome7
Chromosomal Location85221518-85237704 bp(-) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) TCC to TC at 85221550 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000129411 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061074]
Predicted Effect probably null
Transcript: ENSMUST00000061074
SMART Domains Protein: ENSMUSP00000129411
Gene: ENSMUSG00000096861

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
Pfam:ANF_receptor 77 463 4.5e-28 PFAM
Pfam:NCD3G 507 559 1.1e-18 PFAM
Pfam:7tm_3 589 827 3.7e-53 PFAM
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Lpcat2 T C 8: 92,873,055 V217A possibly damaging Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Vmn2r68
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Vmn2r68 APN 7 85237611 missense probably benign
IGL01477:Vmn2r68 APN 7 85233483 missense probably damaging 1.00
IGL01600:Vmn2r68 APN 7 85222260 missense probably benign 0.39
IGL01979:Vmn2r68 APN 7 85222117 missense probably benign
IGL01999:Vmn2r68 APN 7 85222231 missense probably damaging 1.00
IGL02269:Vmn2r68 APN 7 85221739 missense possibly damaging 0.84
IGL02517:Vmn2r68 APN 7 85221945 nonsense probably null
IGL02827:Vmn2r68 APN 7 85237592 missense probably damaging 1.00
IGL02852:Vmn2r68 APN 7 85233387 missense probably damaging 1.00
IGL02982:Vmn2r68 APN 7 85234441 missense probably benign 0.12
IGL03099:Vmn2r68 APN 7 85222240 nonsense probably null
IGL03166:Vmn2r68 APN 7 85222123 missense probably benign 0.01
IGL03168:Vmn2r68 APN 7 85221764 missense probably damaging 1.00
IGL03243:Vmn2r68 APN 7 85233755 missense possibly damaging 0.66
F5770:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
R0280:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0280:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0281:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0281:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0348:Vmn2r68 UTSW 7 85221676 missense possibly damaging 0.50
R0390:Vmn2r68 UTSW 7 85233249 splice site probably benign
R0390:Vmn2r68 UTSW 7 85233258 critical splice donor site probably null
R0722:Vmn2r68 UTSW 7 85221586 missense possibly damaging 0.95
R1129:Vmn2r68 UTSW 7 85237504 splice site probably null
R1136:Vmn2r68 UTSW 7 85222341 missense possibly damaging 0.81
R1319:Vmn2r68 UTSW 7 85232492 missense probably damaging 0.96
R1614:Vmn2r68 UTSW 7 85221738 missense possibly damaging 0.93
R1682:Vmn2r68 UTSW 7 85233366 missense possibly damaging 0.68
R1837:Vmn2r68 UTSW 7 85233678 missense probably damaging 0.96
R1893:Vmn2r68 UTSW 7 85234659 nonsense probably null
R1908:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1909:Vmn2r68 UTSW 7 85234052 missense probably benign 0.09
R1951:Vmn2r68 UTSW 7 85233894 missense probably damaging 1.00
R2177:Vmn2r68 UTSW 7 85221915 missense probably benign 0.01
R2178:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2185:Vmn2r68 UTSW 7 85233693 nonsense probably null
R2188:Vmn2r68 UTSW 7 85221550 frame shift probably null
R2282:Vmn2r68 UTSW 7 85221651 missense possibly damaging 0.65
R2567:Vmn2r68 UTSW 7 85234595 missense probably benign
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2869:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2870:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2871:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2873:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R2874:Vmn2r68 UTSW 7 85233626 missense probably benign 0.25
R3149:Vmn2r68 UTSW 7 85237667 missense probably benign 0.00
R3401:Vmn2r68 UTSW 7 85221550 frame shift probably null
R3978:Vmn2r68 UTSW 7 85232462 missense probably benign 0.00
R4399:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4421:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4478:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4479:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4495:Vmn2r68 UTSW 7 85221550 frame shift probably null
R4628:Vmn2r68 UTSW 7 85234465 missense probably benign 0.00
R4649:Vmn2r68 UTSW 7 85221535 missense probably benign
R4654:Vmn2r68 UTSW 7 85233561 nonsense probably null
R4793:Vmn2r68 UTSW 7 85234440 missense probably benign 0.01
R5007:Vmn2r68 UTSW 7 85232414 missense probably benign
R5021:Vmn2r68 UTSW 7 85233734 missense possibly damaging 0.62
R5082:Vmn2r68 UTSW 7 85233868 missense probably benign 0.12
R5177:Vmn2r68 UTSW 7 85221991 missense probably damaging 0.99
R5221:Vmn2r68 UTSW 7 85221877 missense probably damaging 1.00
R5514:Vmn2r68 UTSW 7 85237559 missense possibly damaging 0.92
R5521:Vmn2r68 UTSW 7 85233718 missense probably benign 0.03
R5563:Vmn2r68 UTSW 7 85222075 missense probably damaging 1.00
R5664:Vmn2r68 UTSW 7 85233770 missense probably benign 0.02
R5829:Vmn2r68 UTSW 7 85237604 missense probably benign 0.00
R6016:Vmn2r68 UTSW 7 85222245 missense probably damaging 0.99
R6356:Vmn2r68 UTSW 7 85233840 missense possibly damaging 0.85
R6413:Vmn2r68 UTSW 7 85221765 missense probably damaging 1.00
R6418:Vmn2r68 UTSW 7 85233707 missense probably benign
R6699:Vmn2r68 UTSW 7 85232375 missense possibly damaging 0.58
V7581:Vmn2r68 UTSW 7 85221880 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TACATGTCTGTACTATCAACATGGC -3'
(R):5'- AGTGTCTGGATTACTTTCATCCCTG -3'

Sequencing Primer
(F):5'- GTTTATTCAACAAACTGTGGTACAGG -3'
(R):5'- TGTCTACCACAGCACCAAAGG -3'
Posted On2015-07-07