Incidental Mutation 'R4401:Lpcat2'
ID326634
Institutional Source Beutler Lab
Gene Symbol Lpcat2
Ensembl Gene ENSMUSG00000033192
Gene Namelysophosphatidylcholine acyltransferase 2
SynonymslysoPAFAT/LPCAT2, LPCAT2, Aytl1a, Aytl1
MMRRC Submission 041132-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.120) question?
Stock #R4401 (G1)
Quality Score225
Status Not validated
Chromosome8
Chromosomal Location92855339-92919279 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 92873055 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 217 (V217A)
Ref Sequence ENSEMBL: ENSMUSP00000049252 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046290] [ENSMUST00000209265] [ENSMUST00000210099]
Predicted Effect possibly damaging
Transcript: ENSMUST00000046290
AA Change: V217A

PolyPhen 2 Score 0.611 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000049252
Gene: ENSMUSG00000033192
AA Change: V217A

DomainStartEndE-ValueType
low complexity region 5 12 N/A INTRINSIC
low complexity region 35 45 N/A INTRINSIC
transmembrane domain 59 81 N/A INTRINSIC
PlsC 140 251 2.78e-22 SMART
Blast:PlsC 284 326 3e-19 BLAST
EFh 395 423 4.49e-4 SMART
EFh 432 460 6.11e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130471
Predicted Effect probably benign
Transcript: ENSMUST00000209265
Predicted Effect probably benign
Transcript: ENSMUST00000210099
Coding Region Coverage
  • 1x: 99.3%
  • 3x: 98.5%
  • 10x: 96.9%
  • 20x: 94.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the lysophospholipid acyltransferase family. The encoded enzyme may function in two ways: to catalyze the biosynthesis of platelet-activating factor (1-O-alkyl-2-acetyl-sn-glycero-3-phosphocholine) from 1-O-alkyl-sn-glycero-3-phosphocholine, and to catalyze the synthesis of glycerophospholipid precursors from arachidonyl-CoA and lysophosphatidylcholine. The encoded protein may function in membrane biogenesis and production of platelet-activating factor in inflammatory cells. The enzyme may localize to the endoplasmic reticulum and the Golgi. [provided by RefSeq, Feb 2009]
Allele List at MGI
Other mutations in this stock
Total: 32 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb1a A G 5: 8,702,390 I454V possibly damaging Het
Acvr2a A G 2: 48,899,702 T486A probably benign Het
Ap3b1 C A 13: 94,418,099 L248I probably damaging Het
Atad2b T A 12: 4,940,145 C157S probably damaging Het
C530008M17Rik G A 5: 76,848,916 V74I probably damaging Het
Cage1 T A 13: 38,023,102 I256F probably damaging Het
Cct2 A G 10: 117,057,809 I287T possibly damaging Het
Cntn4 A G 6: 106,489,664 T176A possibly damaging Het
Cyp2c54 T C 19: 40,072,171 N122S probably benign Het
Cytip T C 2: 58,133,935 D291G probably benign Het
Eef1d C T 15: 75,902,920 V213I probably benign Het
Fnbp4 A G 2: 90,746,758 T145A possibly damaging Het
Fras1 C A 5: 96,642,620 T951K probably damaging Het
Gm11937 C T 11: 99,610,075 V39M probably damaging Het
Gm6712 C T 17: 17,318,104 noncoding transcript Het
Hira A G 16: 18,925,720 I352V probably damaging Het
Homer3 G A 8: 70,290,143 probably null Het
Mroh2a G T 1: 88,254,935 R1195L possibly damaging Het
Olfr1277 A G 2: 111,269,833 F178S probably damaging Het
Olfr447 G T 6: 42,912,326 E268* probably null Het
Olfr561 C T 7: 102,774,799 R92* probably null Het
Pla2g1b T A 5: 115,470,888 Y47* probably null Het
Pqlc2 T C 4: 139,306,543 I22V probably benign Het
Rfng A T 11: 120,782,480 V245E possibly damaging Het
Rpf2 A G 10: 40,236,128 V104A possibly damaging Het
Rps6kc1 G T 1: 190,799,958 H616N probably benign Het
Slc9b2 T C 3: 135,336,544 V528A probably benign Het
Srgap1 T C 10: 121,804,921 probably null Het
Trrap A G 5: 144,843,318 T3240A possibly damaging Het
Vmn2r68 TCC TC 7: 85,221,550 probably null Het
Zfhx4 C A 3: 5,403,345 Y2854* probably null Het
Zfp986 C T 4: 145,898,943 R58C probably benign Het
Other mutations in Lpcat2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00737:Lpcat2 APN 8 92909206 missense probably damaging 1.00
IGL00823:Lpcat2 APN 8 92864970 missense possibly damaging 0.90
IGL00911:Lpcat2 APN 8 92890710 missense probably damaging 0.99
IGL01449:Lpcat2 APN 8 92871147 missense possibly damaging 0.69
IGL01951:Lpcat2 APN 8 92918047 missense probably damaging 1.00
IGL02041:Lpcat2 APN 8 92918181 missense probably benign 0.04
IGL02491:Lpcat2 APN 8 92874251 missense probably damaging 1.00
IGL02957:Lpcat2 APN 8 92875584 nonsense probably null
R0960:Lpcat2 UTSW 8 92869710 missense probably benign
R1236:Lpcat2 UTSW 8 92886569 missense probably damaging 1.00
R1422:Lpcat2 UTSW 8 92879417 missense probably damaging 1.00
R1677:Lpcat2 UTSW 8 92864932 missense probably benign 0.08
R2048:Lpcat2 UTSW 8 92869843 missense possibly damaging 0.94
R3712:Lpcat2 UTSW 8 92918170 missense possibly damaging 0.70
R3919:Lpcat2 UTSW 8 92914274 missense probably damaging 0.99
R3951:Lpcat2 UTSW 8 92864903 missense probably benign
R4357:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4358:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4359:Lpcat2 UTSW 8 92873106 missense probably benign 0.25
R4584:Lpcat2 UTSW 8 92889371 missense probably damaging 1.00
R5089:Lpcat2 UTSW 8 92879443 missense probably damaging 1.00
R5127:Lpcat2 UTSW 8 92909191 missense possibly damaging 0.65
R5185:Lpcat2 UTSW 8 92869737 missense probably benign 0.04
R6380:Lpcat2 UTSW 8 92886581 missense probably benign
R6974:Lpcat2 UTSW 8 92873079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CGTACAAGAAACGTGCGGAC -3'
(R):5'- GCATACGTTCTGTGGAATCAC -3'

Sequencing Primer
(F):5'- CGGACAGCATATTCTAGAAACTAAG -3'
(R):5'- TCACAGCATCAGAAAGATTTTATCAG -3'
Posted On2015-07-07